G147562 (ptprj,LOC108274725)


Basic Information

Item Value
gene id G147562
gene name ptprj,LOC108274725
gene type non-coding
species striped catfish (Pangasianodon hypophthalmus)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_047603.1
NCBI id CM018549.1
chromosome length 29458963
location 12995733 ~ 13015196 (+)
genome version GENO_Phyp_1.0_2019_striped_catfish_Genome

Sequence

>TU174783
TGTGAATGCTGAGATTTGAGCTGGTGCTCCTGCAGTTTGGTTATCTGCAGCAACTGCAGTAACAGAGAATGTGTAGTTCACTCCAGCAGTCAGACCAGAGACAGTGTAAGACGTGTCTGAAGTGTTCCTGCTGTTATTCACACTGCCACCAGTCCATGTTACTATAAAGAAGGACCTGTTCCCATTTGGCTCATTCCAAGTTAGAGACACAGATGATGTGGTTTTGGTAGAGGCA

Function

symbol description
ptprj Enables several functions, including beta-catenin binding activity; delta-catenin binding activity; and gamma-catenin binding activity. Involved in several processes, including negative regulation of signal transduction; positive regulation of focal adhesion assembly; and positive regulation of protein kinase B signaling. Located in cell surface; cell-cell junction; and immunological synapse. Implicated in colorectal cancer.

NR:

description
PREDICTED: receptor-type tyrosine-protein phosphatase eta-like isoform X2

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU174783 True 235 lncRNA 0.46 4 12995733 13015196

Neighbor

gene id symbol gene type direction distance location
phlda2 phlda2,phla2 coding upstream 132178 12862501 ~ 12863555 (+)
nap1l4a nap1l4a,LOC108275311,LOC108439256,LOC107675283 coding upstream 145340 12837011 ~ 12850393 (+)
si:ch211-236l14.4 LOC108274486,LOC108439252 coding upstream 189280 12781288 ~ 12806453 (+)
igf2b LOC100304637,LOC108439251 coding upstream 310912 12680740 ~ 12684821 (+)
th th,LOC108274586 coding upstream 321152 12666989 ~ 12674581 (+)
dusp8a dusp8a,LOC108274976,LOC107675452,LOC107675267,LOC107553852,LOC107744185,LOC107549289,LOC107758748 coding downstream 107947 13123143 ~ 13161929 (+)
mob2a mob2,LOC108274974,LOC108411394 coding downstream 155499 13170695 ~ 13215991 (+)
myod1 myod1,LOC107758742 coding downstream 341037 13356233 ~ 13358154 (+)
pdcd2l pdcd2l coding downstream 450077 13465273 ~ 13470743 (+)
banp banp,LOC107742045 coding downstream 457988 13473184 ~ 13522795 (+)
G147560 ptprj,LOC108274725 non-coding upstream 675 12938597 ~ 12995058 (+)
G147558 ptprj,LOC108274725 non-coding upstream 52672 12939406 ~ 12943061 (+)
G147554 NA non-coding upstream 58029 12932881 ~ 12937704 (+)
G147479 NA non-coding upstream 163667 12831828 ~ 12832066 (+)
G147472 NA non-coding upstream 184404 12810522 ~ 12811329 (+)
G147602 NA non-coding downstream 55059 13070255 ~ 13090505 (+)
G147630 NA non-coding downstream 149380 13164576 ~ 13164790 (+)
G147641 NA non-coding downstream 172495 13187691 ~ 13188284 (+)
LOC117597924 NA non-coding downstream 314446 13329642 ~ 13333044 (+)
G147784 NA non-coding downstream 344839 13360035 ~ 13371776 (+)
G147542 NA other upstream 78479 12916919 ~ 12917254 (+)
atp6v0e1 va0e1,atp6v0e1,LOC106612155 other upstream 1397763 11595499 ~ 11597970 (+)
hrh2a LOC108274475 other upstream 1689415 11295128 ~ 11306318 (+)
LOC113529865 LOC108275059,LOC107660898,LOC106604817 other upstream 2400132 10554366 ~ 10595601 (+)
si:ch73-233f7.1 si:ch73-233f7.1,LOC108274507,LOC107660897,LOC107588310,LOC107596359,LOC107754489,LOC108430952 other upstream 2447804 10537251 ~ 10547929 (+)
zgc:172145 LOC108275003 other downstream 334127 13349323 ~ 13353262 (+)
prr33 prr33,LOC108428828,LOC107595228,LOC107742059,LOC107675453 other downstream 357676 13372872 ~ 13389196 (+)
ces2b LOC108275184 other downstream 746138 13761334 ~ 13776871 (+)
fanci fanci,LOC107673243,LOC107670230,LOC107564606 other downstream 775777 13790973 ~ 13829331 (+)
slc5a12 slc5a12 other downstream 2548110 15563306 ~ 15652684 (+)

Expression


Co-expression Network