LOC113523859


Basic Information

Item Value
gene id LOC113523859
gene name NA
gene type coding
species striped catfish (Pangasianodon hypophthalmus)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_047603.1
NCBI id CM018549.1
chromosome length 29458963
location 3366125 ~ 3366258 (+)
genome version GENO_Phyp_1.0_2019_striped_catfish_Genome

Sequence

>XR_003402472.2
AGCGAGACTAGAGTCACATCCCGACGCTGTTCGTCGTCCTGGTGTGCTATAGCTCTCGCAGATTAATCCCTCTCTGCTTATTCATTGGCTGCTGCTTCTCCATCGCTCGGCCAATCACCAGCTCAGAAACAGAT

Function

GO:

id name namespace
GO:0006629 lipid metabolic process biological_process
GO:0008289 lipid binding molecular_function

KEGG:

id description
ko04975 Fat digestion and absorption
ko04979 Cholesterol metabolism
ko04977 Vitamin digestion and absorption

RNA

RNA id representative length rna type GC content exon number start site end site
XR_003402472.2 True 134 ncRNA 0.52 1 3366125 3366258

Neighbor

gene id symbol gene type direction distance location
LOC113523857 NA coding upstream 1777 3364215 ~ 3364348 (+)
ppt2b ppt2,LOC103364422 coding upstream 9482 3346572 ~ 3356643 (+)
cratb cratb,LOC108274804,LOC108435838,LOC107561339,LOC107563340,LOC107758403,LOC107679039,LOC105903715 coding upstream 57801 3293799 ~ 3308324 (+)
LOC117597933 LOC108279645 coding upstream 116370 3248524 ~ 3249755 (+)
slc39a7 slc39a7,LOC107395789 coding upstream 212279 3146038 ~ 3153846 (+)
LOC113523858 NA coding downstream 1947 3368205 ~ 3368338 (+)
khdrbs3 khdrbs3,LOC107687064,LOC107727300,LOC107566726,LOC102789115 coding downstream 336238 3702496 ~ 3816623 (+)
LOC113523835 LOC108274547,LOC107554574,LOC107669946,LOC107727308 coding downstream 643661 4009919 ~ 4046648 (+)
rragcb rragc,LOC108275365 coding downstream 1101864 4468122 ~ 4479494 (+)
stpg1 stpg1 coding downstream 1159357 4525615 ~ 4530986 (+)
G142545 NA non-coding upstream 14006 3283128 ~ 3352119 (+)
G142553 NA non-coding upstream 44957 3312761 ~ 3321168 (+)
trnac-gca_12 NA non-coding upstream 105180 3260874 ~ 3260945 (+)
trnac-gca_11 NA non-coding upstream 105713 3260341 ~ 3260412 (+)
trnac-gca_10 NA non-coding upstream 106246 3259808 ~ 3259879 (+)
G142573 NA non-coding downstream 13463 3379721 ~ 3381739 (+)
G142580 NA non-coding downstream 24647 3390905 ~ 3391147 (+)
G142575 NA non-coding downstream 49264 3415522 ~ 3435565 (+)
G142584 NA non-coding downstream 53294 3419552 ~ 3421435 (+)
G142908 NA non-coding downstream 250918 3617176 ~ 3624288 (+)
LOC113523823 NA other upstream 333599 2431145 ~ 3032526 (+)
LOC117598067 NA other upstream 557488 2559811 ~ 2808637 (+)
LOC117598057 NA other upstream 673283 2687795 ~ 2692842 (+)
LOC117598105 NA other upstream 807398 2373223 ~ 2558727 (+)
LOC117598104 LOC108274858,LOC108274862,LOC108261310,LOC108274845 other upstream 888167 2475158 ~ 2477958 (+)
LOC113523845 NA other downstream 17922 3384180 ~ 3396067 (+)
G142576 NA other downstream 31412 3397670 ~ 3462171 (+)
fhl3b fhl3,LOC108438237,LOC107734040,LOC107551770,LOC107681628 other downstream 1118575 4484833 ~ 4509248 (+)
gpx3 gpx3 other downstream 2374649 5740907 ~ 5747944 (+)
LOC113547098 deptor,LOC108274614,LOC108442483,LOC107685573 other downstream 3220953 6587211 ~ 6593605 (+)

Expression


Co-expression Network