G287817


Basic Information

Item Value
gene id G287817
gene name NA
gene type non-coding
species striped catfish (Pangasianodon hypophthalmus)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_047613.1
NCBI id CM018559.1
chromosome length 22090854
location 1005667 ~ 1007006 (+)
genome version GENO_Phyp_1.0_2019_striped_catfish_Genome

Sequence

>TU340887
GAGCATTCCCTGACTGGAGAGAGCACTGTGTCTCAAATATGGCCGTGGGAGGTTCATGACAGTGGGACTTCGCTGTCTCTTAAGAAGAAGACTGTCAGAGGTGTCAGAAAGGTTGCAAGTGGTCCTCCAAAAGTACAAGACTGCTTTAGGCCCTGAGGCCTCTGCCCTTCTACATGTTGAAGCAGAAGATCAAATTGGCCTCAGTAGTCCA

Function

NR:

description
unnamed protein product

GO: NA

KEGG:

id description
ko04913 Ovarian steroidogenesis
ko04927 Cortisol synthesis and secretion

RNA

RNA id representative length rna type GC content exon number start site end site
TU340887 True 211 lncRNA 0.50 2 1005667 1007006

Neighbor

gene id symbol gene type direction distance location
LOC117599763 NA coding upstream 108381 897000 ~ 897286 (+)
LOC113525267 NA coding upstream 144177 859667 ~ 861490 (+)
LOC117599758 LOC107715185,LOC107745493,LOC107581013,LOC108417841,LOC107756941,LOC107569589,LOC107738483,LOC107690133,LOC105910449 coding upstream 172842 832360 ~ 832825 (+)
LOC117599761 LOC106958509,LOC105896829,LOC106963510,LOC107690788,LOC107671222 coding upstream 173821 831420 ~ 831846 (+)
LOC117599755 h2afx,LOC107386469,LOC106516344,LOC100693699,LOC101160258,LOC107677420 coding upstream 179504 824677 ~ 826163 (+)
slc5a6a slc5a6,slc5a6a,LOC107601523,LOC107690043,LOC107553475 coding downstream 7878 1014884 ~ 1036096 (+)
LOC117599792 NA coding downstream 196507 1203513 ~ 1208039 (+)
fam102bb fam102b,fam102bb,LOC107555630,LOC107698400,LOC107696175,LOC107601256 coding downstream 286776 1293782 ~ 1332827 (+)
LOC117599793 LOC108257824 coding downstream 333502 1340508 ~ 1344631 (+)
olfml2ba LOC108257824 coding downstream 357078 1364084 ~ 1379201 (+)
G287814 NA non-coding upstream 15232 990210 ~ 990435 (+)
LOC117599769 NA non-coding upstream 79028 926233 ~ 926639 (+)
G287630 NA non-coding upstream 112163 801623 ~ 893504 (+)
G287627 NA non-coding upstream 203143 762431 ~ 802524 (+)
LOC113525268 NA non-coding upstream 537263 454598 ~ 468404 (+)
G287872 NA non-coding downstream 177077 1184083 ~ 1184363 (+)
G287891 NA non-coding downstream 234855 1241861 ~ 1242067 (+)
G287962 NA non-coding downstream 427549 1434555 ~ 1435138 (+)
G288036 NA non-coding downstream 446569 1453575 ~ 1453870 (+)
G288038 NA non-coding downstream 447964 1454970 ~ 1455834 (+)
LOC117599757 LOC108262407,LOC108272324,LOC107745493,LOC108417841,LOC107715185,LOC107581013,LOC107738483,LOC107690133,LOC108419634,LOC107756941,LOC107569589 other upstream 107257 807193 ~ 898410 (+)
G287625 LOC106958509,LOC105896829,LOC107690788,LOC107726395,LOC107671222,LOC107579420,LOC107719248,LOC106963510,LOC107723971 other upstream 108305 806306 ~ 897362 (+)
G287892 NA other downstream 236051 1243057 ~ 1243672 (+)
LOC117599677 NA other downstream 252170 1259176 ~ 1264632 (+)
srp9 srp9,LOC107553440,LOC107601484 other downstream 351180 1358186 ~ 1360116 (+)
ptchd4 ptchd4,LOC107732383,LOC107553442,LOC107732542,LOC107601530 other downstream 989114 1996120 ~ 2021263 (+)
LOC113546780 NA other downstream 1126152 2133158 ~ 2142181 (+)

Expression


Co-expression Network