G282404


Basic Information

Item Value
gene id G282404
gene name NA
gene type non-coding
species striped catfish (Pangasianodon hypophthalmus)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_047612.1
NCBI id CM018558.1
chromosome length 23372418
location 14332932 ~ 14333132 (-)
genome version GENO_Phyp_1.0_2019_striped_catfish_Genome

Sequence

>TU334694
cacgagctcgtcgtcttctaattagcagctgaaataggcaaatgttaagtctgctttttaaaacgaaaaaaagaagcaatggcaagagagtggctgctagtatctgcgtgttggaacggctggaaacgtgtaatcgtgcactgtgcgcatgtcagaagattctgtcatgtaaacgcgcatatcaacccgattactttattc

Function

GO:

id name namespace
GO:0005201 extracellular matrix structural constituent molecular_function

KEGG:

id description
ko04512 ECM-receptor interaction
ko04974 Protein digestion and absorption

RNA

RNA id representative length rna type GC content exon number start site end site
TU334694 True 201 lncRNA 0.43 1 14332932 14333132

Neighbor

gene id symbol gene type direction distance location
kin kin coding downstream 474259 13851543 ~ 13858673 (-)
LOC113531720 itih5 coding downstream 503424 13808409 ~ 13829508 (-)
LOC113532385 kcna1a,kcna1l,LOC108279524,LOC108425346,LOC105912431 coding downstream 545498 13782762 ~ 13787434 (-)
LOC117599536 itih5 coding downstream 569142 13751523 ~ 13763790 (-)
sfmbt2 sfmbt2 coding downstream 608302 13665323 ~ 13724630 (-)
LOC113531970 LOC108279954 coding upstream 540718 14873850 ~ 14885572 (-)
slc6a1l LOC108279609,LOC108427058,LOC107584717,LOC107689715,LOC107748475,LOC107597007,LOC101061665 coding upstream 699516 15032648 ~ 15047471 (-)
LOC113531968 LOC108279915,LOC107597036 coding upstream 726380 15059512 ~ 15078787 (-)
pyroxd1 pyroxd1,LOC108279593 coding upstream 768224 15101356 ~ 15111265 (-)
LOC113531721 iapp coding upstream 783095 15116227 ~ 15118561 (-)
G282368 NA non-coding downstream 363035 13953999 ~ 13969897 (-)
G282349 NA non-coding downstream 395053 13937656 ~ 13937879 (-)
G282283 itih2,LOC106576198 non-coding downstream 492338 13838658 ~ 13840594 (-)
G282279 itih2,LOC107555817 non-coding downstream 495501 13833248 ~ 13837431 (-)
LOC117599591 NA non-coding downstream 757557 13571800 ~ 13575375 (-)
G282409 NA non-coding upstream 39599 14372731 ~ 14373513 (-)
G282410 NA non-coding upstream 56691 14389823 ~ 14390557 (-)
G282649 NA non-coding upstream 381913 14715045 ~ 14731004 (-)
G282673 NA non-coding upstream 406084 14739216 ~ 14739437 (-)
G282718 NA non-coding upstream 479790 14812922 ~ 15105995 (-)
dusp16 dusp16 other downstream 2580019 11721063 ~ 11752913 (-)
G281092 mansc1 other downstream 2672605 11657890 ~ 11660327 (-)
G281074 rad51ap1 other downstream 2744908 11586304 ~ 11588024 (-)
vegfab vegfa,LOC108435123 other downstream 3073520 11238935 ~ 11259412 (-)
sobpb LOC108279441 other downstream 3238756 11079168 ~ 11094176 (-)
LOC113531972 muc19,LOC108280038 other upstream 806793 15139925 ~ 15184075 (-)
alg12 alg12 other upstream 2067789 16400921 ~ 16406863 (-)
LOC113532230 LOC108280029,LOC107562148,LOC107687569,LOC107741714,LOC105912408 other upstream 2505403 16838535 ~ 16853395 (-)
phf21b phf21b other upstream 2625380 16958512 ~ 17027865 (-)
LOC113532261 smkr1 other upstream 3645631 17978763 ~ 17988280 (-)

Expression


Co-expression Network