G60503


Basic Information

Item Value
gene id G60503
gene name NA
gene type non-coding
species striped catfish (Pangasianodon hypophthalmus)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_047598.1
NCBI id CM018544.1
chromosome length 33267568
location 6641971 ~ 6642185 (-)
genome version GENO_Phyp_1.0_2019_striped_catfish_Genome

Sequence

>TU71581
CTGGAAGGAGTACGGCTGGGCAGCACTCTAATGTACATCATCTCCCACGATCATTGGGGGCAGGTACAGTGTCTAGTATAGTGGGTAGTACAGCTGTTGCTTGGTTCCGTCCTTGGGACTGAAGGTTTAGAGGGTAGGTTTTTGTTTAGTTCATCGCTGGGGCGACGATGCAGAAGCTGGGGGTGGATTGTGACAGTATGAATGAGGTAAGTGGT

Function

GO:

id name namespace
GO:0002682 regulation of immune system process biological_process

KEGG:

id description
ko04662 B cell receptor signaling pathway

RNA

RNA id representative length rna type GC content exon number start site end site
TU71581 True 215 lncRNA 0.51 1 6641971 6642185

Neighbor

gene id symbol gene type direction distance location
LOC113547256 LOC108267788 coding downstream 29129 6602800 ~ 6612842 (-)
mylk4a LOC108268043 coding downstream 81645 6518463 ~ 6560326 (-)
trnak-cuu_3 NA coding downstream 461012 6180887 ~ 6180959 (-)
ripk1l ripk1 coding downstream 655756 5972624 ~ 5986215 (-)
LOC113547282 LOC108267872 coding downstream 674667 5956127 ~ 5967304 (-)
LOC117597185 NA coding upstream 133794 6775979 ~ 6778040 (-)
LOC117597065 NA coding upstream 136171 6778356 ~ 6779988 (-)
LOC117597066 NA coding upstream 137810 6779995 ~ 6789815 (-)
LOC117597067 NA coding upstream 152900 6795085 ~ 6798486 (-)
LOC117597003 NA coding upstream 167944 6810129 ~ 6812432 (-)
LOC113547257 NA non-coding downstream 39745 6587543 ~ 6602226 (-)
trnae-cuc_12 NA non-coding downstream 198156 6443744 ~ 6443815 (-)
G60333 NA non-coding downstream 246900 6394865 ~ 6395071 (-)
G60328 NA non-coding downstream 251894 6389703 ~ 6390077 (-)
G60311 NA non-coding downstream 262074 6379698 ~ 6379897 (-)
G60672 NA non-coding upstream 143142 6785327 ~ 6792952 (-)
G60669 NA non-coding upstream 236459 6878644 ~ 6881335 (-)
G60727 NA non-coding upstream 588469 7230654 ~ 7230904 (-)
G60726 NA non-coding upstream 599940 7242125 ~ 7246436 (-)
G60846 NA non-coding upstream 799077 7441262 ~ 7538818 (-)
G60166 phlpp1,LOC105899321,LOC101073770,LOC106925929,LOC103142993,LOC103135813 other downstream 682426 5900249 ~ 5959545 (-)
cldn1 LOC108268314 other downstream 1147932 5478542 ~ 5494039 (-)
LOC113547297 NA other downstream 1555614 5082808 ~ 5086357 (-)
LOC117597188 LOC108262218,LOC108262433 other downstream 1696950 4928360 ~ 4945021 (-)
LOC113547272 LOC108268233,LOC108269831,LOC108268231,LOC108261094,LOC108268232 other downstream 1994091 4642020 ~ 4647880 (-)
LOC117597002 LOC107721237 other upstream 239197 6881382 ~ 6899227 (-)
LOC113526822 LOC108268278 other upstream 1810425 8452610 ~ 8551855 (-)
LOC113526753 LOC108267287,LOC108261139 other upstream 1929311 8571496 ~ 8595625 (-)
LOC113526752 LOC100862731,LOC108267340,LOC108267722,LOC108267272,LOC108267273,LOC108261494,LOC108267212,LOC108261855,LOC100379168 other upstream 1997283 8639468 ~ 9528825 (-)
G61478 NA other upstream 2341049 8983234 ~ 8984453 (-)

Expression


Co-expression Network