G70798 (pappa2)


Basic Information

Item Value
gene id G70798
gene name pappa2
gene type non-coding
species striped catfish (Pangasianodon hypophthalmus)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_047598.1
NCBI id CM018544.1
chromosome length 33267568
location 25613444 ~ 25613676 (+)
genome version GENO_Phyp_1.0_2019_striped_catfish_Genome

Sequence

>TU83932
GGTAGTGGATAGGTCCACAGGTGTCATTGACCAGGCCAGGGTCTTGGCATGCTTTTGACTTTGGGGTTGGAGCCGTGTCAGCACAGAAATCTCCAGTTTCCATGGACGCTGTGGTCTCCTGACATGGGTCTTCACATGACTCACGCTCGCTCACCCCCTTGAAGACATGGTACAGTCCAAAAATGTGGCCCATCTCATGGATCATGGTATTGTTGTGACCAACAGTGCCAAAA

Function

symbol description
pappa2 Enables peptidase activity. Acts upstream of or within several processes, including angiogenesis; notochord development; and regulation of Notch signaling pathway. Is expressed in several structures, including axial mesoderm; bone tissue; nervous system; pleuroperitoneal region; and ventral mandibular arch. Orthologous to human PAPPA2 (pappalysin 2).

NR:

description
PREDICTED: pappalysin-2

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU83932 True 233 lncRNA 0.52 1 25613444 25613676

Neighbor

gene id symbol gene type direction distance location
astn1 astn1 coding upstream 60605 25270222 ~ 25552839 (+)
dars2 dars2,LOC107658301,LOC104960769,LOC104948518 coding upstream 566127 25021613 ~ 25047317 (+)
klhl20 klhl20,LOC106569069 coding upstream 600138 24994877 ~ 25013306 (+)
kiss1ra kiss1ra,LOC108267265,LOC108411985,LOC107657423,LOC107599909 coding upstream 806040 24792295 ~ 24807404 (+)
zgc:113531 LOC108267389,LOC108430294,LOC106532842,LOC105940236,LOC107081705 coding upstream 1016335 24587207 ~ 24597109 (+)
cop1 rfwd2,LOC107722073,LOC107726924 coding downstream 29726 25643402 ~ 25664410 (+)
mrps14 mrps14,LOC107678929,LOC107726917,LOC107559053,LOC107563590 coding downstream 337478 25951154 ~ 25953899 (+)
cacybp cacybp,LOC100304883 coding downstream 341280 25954956 ~ 25964158 (+)
plk3 plk3,LOC107726922,LOC107557223,LOC107722069,LOC107658359,LOC107678927 coding downstream 360205 25973881 ~ 25979456 (+)
rasal2 rasal2,LOC107678931 coding downstream 429247 26042923 ~ 26124146 (+)
G70782 NA non-coding upstream 23257 25589967 ~ 25590187 (+)
G70780 NA non-coding upstream 26986 25586253 ~ 25586458 (+)
G70778 NA non-coding upstream 27910 25585326 ~ 25585534 (+)
G70763 LOC107732307 non-coding upstream 52098 25558427 ~ 25561346 (+)
G70695 NA non-coding upstream 55683 25556837 ~ 25557761 (+)
G70808 NA non-coding downstream 13037 25626713 ~ 25626937 (+)
G70813 NA non-coding downstream 39762 25653438 ~ 25690117 (+)
G71163 tnn non-coding downstream 310276 25923952 ~ 25928740 (+)
G71322 NA non-coding downstream 425506 26039182 ~ 26039383 (+)
G71329 NA non-coding downstream 514943 26128619 ~ 26128826 (+)
kif2c kif2c other upstream 742181 24859026 ~ 24871263 (+)
G69971 NA other upstream 1503555 24108795 ~ 24109889 (+)
klhl18 klhl18,LOC107657445,LOC107701005,LOC107733883,LOC107730797 other upstream 1507221 24028106 ~ 24106223 (+)
G69509 LOC108267411 other upstream 2293101 23318504 ~ 23320343 (+)
LOC113540463 NA other upstream 2960997 22649810 ~ 22652447 (+)
tnr tnr other downstream 94151 25707827 ~ 25881110 (+)
LOC113539772 kiaa0040 other downstream 283341 25897017 ~ 25902006 (+)
LOC117597118 LOC108261462,LOC108261092,LOC108261095 other downstream 602388 26216064 ~ 26224038 (+)
G71385 NA other downstream 615088 26228764 ~ 26229191 (+)
zgc:66427 zgc:66427,LOC108267510,LOC107738154,LOC101067737,LOC107100876,LOC103396713,LOC104950485,LOC107659393,LOC107668973,LOC107706368,LOC107557724,LOC107591360 other downstream 674614 26288290 ~ 26292784 (+)

Expression


Co-expression Network