G74309 (psmb5,LOC107668975,LOC106569426,LOC107558100)


Basic Information

Item Value
gene id G74309
gene name psmb5,LOC107668975,LOC106569426,LOC107558100
gene type non-coding
species striped catfish (Pangasianodon hypophthalmus)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_047598.1
NCBI id CM018544.1
chromosome length 33267568
location 31531453 ~ 31533223 (+)
genome version GENO_Phyp_1.0_2019_striped_catfish_Genome

Sequence

>TU88025
CCCCCTCTTGTCCCAGCCGCAGACCATGGTGCCCATGCTCAGACCCATGCCTTTGTACTGGTACACCATGTTAGCCAGCAGTTTGGAGGCGGCCGCGACTGAAATGCGCTCCTTGTTGCGCAGCTCGTAGATGCGGCACTGCCTCGCCAGCAGACGCTCCCAGAAACTGCAGTCAGCAGCTCCGCCTGCCATGGTGCCCAGCAGATACGGGTTGATCTCGATGACCTTCTTCACTGTCTGAGAGGCGATGTACGACCCAGCTGTCGCCCGGGAGTCCACTGCCACGATGACGCCGTGCTGAAATTTAAACGCTAAAGTAGTTGTTCCGTGAAGAAACTCAATTTTTCTCTCAATTCCATCTTCTTCTCCTTCAAAAGGGCTCAGTGCGAAATTGAGACGCTCTCCTGAAGCTTCACCGACGCCGAGATCTGCATCGTTAAAGCCACAGCCGAATGGAAAAGACTGTTCAAAATCCGCACACTCACTCTTCAGCACATCAGCCAGCGCCATCTTTACAAATATCACCAG

Function

symbol description
psmb5 Predicted to enable endopeptidase activity. Predicted to be involved in proteasomal protein catabolic process. Predicted to act upstream of or within proteasome-mediated ubiquitin-dependent protein catabolic process. Predicted to be located in cytoplasm. Predicted to be part of proteasome core complex, beta-subunit complex. Predicted to be active in nucleus. Is expressed in female organism. Orthologous to human PSMB5 (proteasome 20S subunit beta 5).

NR:

description
PREDICTED: proteasome subunit beta type-5

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU88025 True 528 lncRNA 0.54 2 31531453 31533223

Neighbor

gene id symbol gene type direction distance location
si:ch211-119o8.6 LOC108268351 coding upstream 287374 31239568 ~ 31244079 (+)
copb2 copb2,LOC107567551,LOC107694662,LOC107706339 coding upstream 294552 31222287 ~ 31236901 (+)
LOC113540056 LOC108267180 coding upstream 310433 31218928 ~ 31221020 (+)
clstn2 clstn2,LOC107668970,LOC107738117 coding upstream 319120 31130107 ~ 31212333 (+)
slc25a36a slc25a36,slc25a36a,LOC108440632,LOC107668959,LOC107706334,LOC107694658 coding upstream 502577 31005423 ~ 31028876 (+)
prmt5 prmt5,LOC107694666,LOC107668985,LOC107558089 coding downstream 15057 31548280 ~ 31560707 (+)
ap1g2 LOC108267338,LOC108438930,LOC105021476,LOC106569429,LOC100380629 coding downstream 33058 31566281 ~ 31581540 (+)
zp3f.2 NA coding downstream 50877 31584100 ~ 31586755 (+)
LOC113540625 LOC108267346 coding downstream 54038 31587261 ~ 31594687 (+)
dhx9 dhx9 coding downstream 63291 31596514 ~ 31610197 (+)
LOC117597166 NA non-coding upstream 257 31524103 ~ 31531196 (+)
G74315 NA non-coding upstream 3383 31527856 ~ 31528070 (+)
G74199 NA non-coding upstream 175332 31355554 ~ 31356121 (+)
G74158 rem2,LOC108268350,LOC108442842 non-coding upstream 280696 31247090 ~ 31250757 (+)
G74006 NA non-coding upstream 500083 31030388 ~ 31031370 (+)
LOC117597165 NA non-coding downstream 11475 31544698 ~ 31546795 (+)
G74370 NA non-coding downstream 174005 31707228 ~ 31707436 (+)
G74384 NA non-coding downstream 201433 31734656 ~ 31743095 (+)
LOC113540254 NA non-coding downstream 244898 31778121 ~ 31847866 (+)
LOC117597031 NA non-coding downstream 326737 31859960 ~ 31863157 (+)
c4h22orf39 c7h22orf39 other upstream 178309 31351201 ~ 31353144 (+)
spsb4a spsb4a,LOC108267127,LOC108440634,LOC103021520,LOC107706335,LOC107561810,LOC107694659,LOC107583109 other upstream 433524 31061730 ~ 31097929 (+)
G73944 NA other upstream 764321 30746131 ~ 30767132 (+)
uggt1 uggt1,LOC107748935,LOC107683622,LOC107727334 other upstream 1053160 30454757 ~ 30478293 (+)
zgc:153115 LOC108268059 other upstream 1850278 29673514 ~ 29681175 (+)
LOC113540067 NA other downstream 226666 31759889 ~ 31776798 (+)
LOC117597173 NA other downstream 425799 31959022 ~ 32330845 (+)
LOC117597122 NA other downstream 427646 31960869 ~ 31965136 (+)
LOC117596936 NA other downstream 433976 31967199 ~ 31967957 (+)
LOC117597123 NA other downstream 437711 31970934 ~ 31972279 (+)

Expression


Co-expression Network