G74747


Basic Information

Item Value
gene id G74747
gene name NA
gene type non-coding
species striped catfish (Pangasianodon hypophthalmus)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_047598.1
NCBI id CM018544.1
chromosome length 33267568
location 33125668 ~ 33125884 (+)
genome version GENO_Phyp_1.0_2019_striped_catfish_Genome

Sequence

>TU88574
caaggctcactgatgcgtgtggggagtgaaggtccgtctggtccaatcccacagaagagctactgtagcacaaactgctgaaaaagttaaagctgctctgatagaaaggagtcagaacacacagtgcagtgcagcttgctgcgtatggagctgcgtagctgcagagcggtcagagagcccatgctgaccctgtccaccacccaaagctcctacaatg

Function

GO:

id name namespace
GO:0034220 ion transmembrane transport biological_process
GO:0035725 sodium ion transmembrane transport biological_process

KEGG:

id description
ko00760 Nicotinate and nicotinamide metabolism

RNA

RNA id representative length rna type GC content exon number start site end site
TU88574 True 217 lncRNA 0.53 1 33125668 33125884

Neighbor

gene id symbol gene type direction distance location
LOC117597132 NA coding upstream 598008 32524877 ~ 32527660 (+)
LOC117596939 NA coding upstream 632044 32492958 ~ 32493624 (+)
LOC117596954 NA coding upstream 648905 32476272 ~ 32476763 (+)
LOC117597131 NA coding upstream 720567 32404548 ~ 32405101 (+)
LOC117596953 NA coding upstream 728271 32396906 ~ 32397397 (+)
chd8 chd8,LOC108267737,LOC107738141,LOC107591376,LOC107704282 coding downstream 48590 33174474 ~ 33249659 (+)
gpr25 LOC108267152 coding downstream 131345 33257229 ~ 33259292 (+)
G74686 NA non-coding upstream 101337 33023976 ~ 33024331 (+)
LOC117596970 NA non-coding upstream 198654 32926616 ~ 32927014 (+)
G74672 NA non-coding upstream 200933 32896804 ~ 32924735 (+)
G74676 NA non-coding upstream 209695 32915540 ~ 32915973 (+)
LOC117596944 NA non-coding upstream 244303 32880711 ~ 32881365 (+)
G74750 NA non-coding downstream 22653 33148537 ~ 33149053 (+)
LOC117597138 NA other upstream 377875 32745500 ~ 32747793 (+)
LOC117596925 NA other upstream 382531 32742265 ~ 32743137 (+)
LOC117597137 NA other upstream 389397 32721824 ~ 32736271 (+)
LOC117596949 NA other upstream 405204 32713173 ~ 32720464 (+)
mmp14b mmp14b,LOC108267723,LOC103041213,LOC108438939 other downstream 4159 33130043 ~ 33148431 (+)

Expression


Co-expression Network