G41653 (herc3,LOC108263070,LOC108441136,LOC108441137,LOC108262885)


Basic Information

Item Value
gene id G41653
gene name herc3,LOC108263070,LOC108441136,LOC108441137,LOC108262885
gene type non-coding
species striped catfish (Pangasianodon hypophthalmus)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_047597.1
NCBI id CM018543.1
chromosome length 33776708
location 6598703 ~ 6598967 (+)
genome version GENO_Phyp_1.0_2019_striped_catfish_Genome

Sequence

>TU49279
GCAGATTCAAACAGAGCTGAGTTTATAGTACACGACAGTAAAGTCAGTACCTTCAGTGTCTCCCAGGCCCAGCTGCCCAGCGCTGTTCCTGCCCCAGCCGAACACGGCTCCGGAGAGAGACAGGGCGAAGCTGTGGTCTCCTCCAGCGCTGATCTGAGCCAGCGGGATCCCAGACAGAGACTTAAGGAGCTGAGGAGACTCGGCTTGGCTTGGCTTACCTTTCCCCAAACCCAGCTGACCGCTCGAGTTCTGACCCCACGTGAAC

Function

symbol description
herc3 Predicted to enable ubiquitin-protein transferase activity. Orthologous to human HERC3 (HECT and RLD domain containing E3 ubiquitin protein ligase 3).

NR:

description
PREDICTED: probable E3 ubiquitin-protein ligase HERC3

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU49279 True 265 lncRNA 0.58 1 6598703 6598967

Neighbor

gene id symbol gene type direction distance location
fam13a fam13a coding upstream 52648 6466066 ~ 6546055 (+)
zgc:154142 LOC108262754 coding upstream 134718 6418262 ~ 6463985 (+)
gprin3 LOC108262861 coding upstream 193100 6398894 ~ 6405603 (+)
ucp1 ucp1,LOC107703842 coding upstream 215243 6375569 ~ 6383460 (+)
tbc1d9 tbc1d9,LOC107594295,LOC107598515 coding upstream 227675 6326860 ~ 6371028 (+)
ppm1k ppm1k,LOC108262962,LOC107706815,LOC107675910,LOC107594437,LOC107729359,LOC107684283 coding downstream 63411 6662378 ~ 6680286 (+)
abcg2d LOC108261237,LOC108262954,LOC108262959,LOC108441148 coding downstream 82174 6681141 ~ 6699519 (+)
papss1 papss1 coding downstream 119884 6718851 ~ 6748064 (+)
dkk2 dkk2 coding downstream 180439 6779406 ~ 6795508 (+)
tbck tbck,LOC107757006,LOC107675790,LOC107594431,LOC107729351,LOC107684277 coding downstream 245905 6844872 ~ 6917655 (+)
G41651 NA non-coding upstream 13255 6584855 ~ 6585448 (+)
G41600 NA non-coding upstream 46588 6519059 ~ 6552115 (+)
G41345 NA non-coding upstream 294598 6303897 ~ 6304105 (+)
G41331 NA non-coding upstream 335400 6260605 ~ 6263303 (+)
LOC117596795 NA non-coding upstream 336272 6239367 ~ 6262431 (+)
G41654 NA non-coding downstream 2945 6601912 ~ 6602163 (+)
G41752 pkd2 non-coding downstream 63315 6662282 ~ 6702806 (+)
G41857 NA non-coding downstream 352425 6951392 ~ 6968839 (+)
G41951 NA non-coding downstream 417737 7016704 ~ 7016925 (+)
G42093 NA non-coding downstream 749192 7348159 ~ 7393784 (+)
inpp4b inpp4b,LOC107703845,LOC107657998 other upstream 370018 5895431 ~ 6228685 (+)
znf827 znf827 other upstream 1240843 5263582 ~ 5357860 (+)
G41047 NA other upstream 1256953 5318534 ~ 5341750 (+)
nr3c2 nr3c2,LOC107598757 other upstream 1827099 4664316 ~ 4771604 (+)
LOC113545357 NA other upstream 2764077 3831867 ~ 3834626 (+)
G42075 NA other downstream 604983 7203950 ~ 7221023 (+)
scoca scoca,scoc,LOC108263532,LOC107737083,LOC107674238,LOC103034491,LOC107556533,LOC107671340 other downstream 1021578 7620545 ~ 7630140 (+)
naa15b naa15b,LOC108263533,LOC108434806,LOC107712022,LOC107671368,LOC107737080 other downstream 1050231 7649198 ~ 7671410 (+)
G42685 NA other downstream 1866780 8465747 ~ 8466312 (+)
trnak-cuu NA other downstream 1870657 8469624 ~ 8469881 (+)

Expression


Co-expression Network