G42307


Basic Information

Item Value
gene id G42307
gene name NA
gene type non-coding
species striped catfish (Pangasianodon hypophthalmus)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_047597.1
NCBI id CM018543.1
chromosome length 33776708
location 7733442 ~ 7733655 (+)
genome version GENO_Phyp_1.0_2019_striped_catfish_Genome

Sequence

>TU50032
TATGCAAAGACAGGGTAAACACAAAGATAAGTACTGCAGGCTGGTGGGTAACACAGATAGAGACACTAGGTAAATGACTGAGGGAAAAGGAGCACACACCTCACGTGTCTTGGAAGGGGAATGCTGGAGAAAACGTAGGGAGATGTAGAGGAGCTTCAAATGAACACAGGTACTCACAGAGAAGAGGTCTATTCCTAGTTGAGGCCAGACAAAG

Function

GO:

id name namespace
GO:0006833 water transport biological_process
GO:0008146 sulfotransferase activity molecular_function
GO:0016782 transferase activity, transferring sulfur-containing groups molecular_function

KEGG:

id description
ko00830 Retinol metabolism
ko00980 Metabolism of xenobiotics by cytochrome P450
ko00982 Drug metabolism - cytochrome P450
ko05204 Chemical carcinogenesis - DNA adducts

RNA

RNA id representative length rna type GC content exon number start site end site
TU50032 True 214 lncRNA 0.46 1 7733442 7733655

Neighbor

gene id symbol gene type direction distance location
LOC113543264 NA coding upstream 20896 7704449 ~ 7712546 (+)
htra3a LOC108263851 coding upstream 38915 7680769 ~ 7694527 (+)
LOC113543305 LOC108262750 coding upstream 55583 7675236 ~ 7677859 (+)
LOC113543333 LOC108263754,LOC108444223,LOC103040975,LOC107674259,LOC107737089,LOC107559635,LOC107551115,LOC105903933 coding upstream 312513 7413508 ~ 7420929 (+)
LOC113543274 LOC108263610 coding upstream 325326 7396425 ~ 7408116 (+)
gpr78a NA coding downstream 15981 7749636 ~ 7755159 (+)
cpz LOC108263841,LOC108434808 coding downstream 23955 7757610 ~ 7771338 (+)
lrpap1 lrpap1,LOC107749950,LOC107551171,LOC107714242,LOC107556528,LOC107674255 coding downstream 336166 8069821 ~ 8080290 (+)
paip2b paip2b,LOC108263850,LOC107551309,LOC107674237,LOC103039606,LOC105904045 coding downstream 708130 8441785 ~ 8445916 (+)
dok1a LOC108262454 coding downstream 715002 8448657 ~ 8452951 (+)
G42304 NA non-coding upstream 11591 7721649 ~ 7721851 (+)
G42295 NA non-coding upstream 88520 7640935 ~ 7644922 (+)
LOC117596850 NA non-coding upstream 258402 7473370 ~ 7475040 (+)
G42208 NA non-coding upstream 311146 7422091 ~ 7422296 (+)
G42093 NA non-coding upstream 339658 7348159 ~ 7393784 (+)
G42442 NA non-coding downstream 133020 7866675 ~ 7866918 (+)
G42447 NA non-coding downstream 175769 7909424 ~ 7909698 (+)
G42522 NA non-coding downstream 441830 8175485 ~ 8176073 (+)
G42531 NA non-coding downstream 456375 8190030 ~ 8190247 (+)
G42498 NA non-coding downstream 463217 8196872 ~ 8197242 (+)
naa15b naa15b,LOC108263533,LOC108434806,LOC107712022,LOC107671368,LOC107737080 other upstream 62032 7649198 ~ 7671410 (+)
scoca scoca,scoc,LOC108263532,LOC107737083,LOC107674238,LOC103034491,LOC107556533,LOC107671340 other upstream 103302 7620545 ~ 7630140 (+)
G42075 NA other upstream 512419 7203950 ~ 7221023 (+)
inpp4b inpp4b,LOC107703845,LOC107657998 other upstream 1504757 5895431 ~ 6228685 (+)
G41047 NA other upstream 2391692 5318534 ~ 5341750 (+)
G42685 NA other downstream 732092 8465747 ~ 8466312 (+)
trnak-cuu NA other downstream 735969 8469624 ~ 8469881 (+)
sprn sprn other downstream 2818604 10552259 ~ 10558295 (+)
LOC113543929 kmo,LOC101885014,LOC107549141,LOC107665616 other downstream 2860919 10594574 ~ 10608704 (+)
dntt dntt other downstream 3365938 11099593 ~ 11207862 (+)

Expression


Co-expression Network