G170782 (ush2a,LOC108444108)


Basic Information

Item Value
gene id G170782
gene name ush2a,LOC108444108
gene type non-coding
species striped catfish (Pangasianodon hypophthalmus)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_047604.1
NCBI id CM018550.1
chromosome length 29376037
location 23704296 ~ 23704511 (-)
genome version GENO_Phyp_1.0_2019_striped_catfish_Genome

Sequence

>TU202102
GGATGGATGGTACGGTCCATGATGCATTCAGGGAGTGGGAAGTAACATTGGACACGATGGGTGGCTCTACTATTGCTGGGGCTGCCTCCAGTGTTCTAACTGTAGTTGACTGGCTGGTAACGCAGCCTGCTATTGTGCATGCGATAACTGCATAGCTGTAGTTAGTGTAAGCAGTCAAATCCTCATCGGTGTAGTTTAACACGGACGGGTCAAAGC

Function

symbol description
ush2a Acts upstream of or within eye photoreceptor cell development; response to auditory stimulus; and sensory perception of light stimulus. Predicted to be located in extracellular region and membrane. Predicted to be integral component of membrane. Predicted to be active in basement membrane. Is expressed in eye and photoreceptor cell. Used to study Usher syndrome type 2 and Usher syndrome type 2A. Human ortholog(s) of this gene implicated in Usher syndrome (multiple); nonsyndromic deafness; and retinitis pigmentosa (multiple). Orthologous to human USH2A (usherin).

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU202102 True 216 lncRNA 0.50 1 23704296 23704511

Neighbor

gene id symbol gene type direction distance location
spata17 spata17 coding downstream 439231 23234593 ~ 23265065 (-)
lpin1 lpin1 coding downstream 556558 23113368 ~ 23147738 (-)
LOC113533941 fut8a,LOC108270174,LOC108433921,LOC107752771,LOC107592788,LOC107674109 coding downstream 870304 22767942 ~ 22833992 (-)
LOC113534106 NA coding downstream 966801 22582782 ~ 22737495 (-)
dync1h1 dync1h1 coding downstream 1356143 22285848 ~ 22348153 (-)
kctd3 kctd3,LOC107590917,LOC107719476,LOC107697722,LOC107733121 coding upstream 17283 23721794 ~ 23735252 (-)
ptpreb ptpreb,LOC108270210,LOC107590916,LOC108444109,LOC107582256 coding upstream 35508 23740019 ~ 23760260 (-)
LOC113534104 klhl28,LOC106581578 coding upstream 75504 23780015 ~ 23792144 (-)
soul3 LOC108269867 coding upstream 122537 23827048 ~ 23836772 (-)
LOC113534026 slc25a29,LOC107687216,LOC107557018 coding upstream 164580 23869091 ~ 23876957 (-)
LOC117598237 NA non-coding downstream 475140 23201694 ~ 23229156 (-)
G170558 NA non-coding downstream 598351 23105235 ~ 23105945 (-)
G170477 NA non-coding downstream 712394 22986696 ~ 22991902 (-)
G170478 NA non-coding downstream 717674 22985083 ~ 22986622 (-)
G170476 NA non-coding downstream 719935 22983951 ~ 22984361 (-)
G170795 NA non-coding upstream 14034 23718545 ~ 23718769 (-)
G170779 NA non-coding upstream 15600 23720111 ~ 23744432 (-)
G170805 NA non-coding upstream 72044 23776555 ~ 23777311 (-)
G170788 NA non-coding upstream 73468 23777979 ~ 23779234 (-)
G170852 NA non-coding upstream 189613 23894124 ~ 23894355 (-)
greb1 greb1 other downstream 524785 23148743 ~ 23179511 (-)
G170435 NA other downstream 840529 22855494 ~ 22863767 (-)
G170023 NA other downstream 1588420 22115565 ~ 22115876 (-)
bmf1 bmf other downstream 2584671 21088303 ~ 21119625 (-)
grem1b LOC108269477 other downstream 2886857 20813689 ~ 20817439 (-)
luzp1 luzp1 other upstream 785727 24490238 ~ 24544079 (-)
G171256 NA other upstream 1076771 24781282 ~ 24926224 (-)
G171569 NA other upstream 1554328 25258839 ~ 25259362 (-)
G171734 NA other upstream 1874428 25578939 ~ 25582527 (-)
foxn3 foxn3,LOC107583483,LOC107755777,LOC107751738,LOC107693108,LOC107680774 other upstream 3860747 27565258 ~ 27652301 (-)

Expression


Co-expression Network