G171021 (ect2l)


Basic Information

Item Value
gene id G171021
gene name ect2l
gene type non-coding
species striped catfish (Pangasianodon hypophthalmus)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_047604.1
NCBI id CM018550.1
chromosome length 29376037
location 24317534 ~ 24318066 (+)
genome version GENO_Phyp_1.0_2019_striped_catfish_Genome

Sequence

>TU202378
GGACAAGACTGGTAGTACGACTCAGAGGTAGGAGGCTAGATTTCTGTCTGAAACTGCTTGCATATGTTCCTTTTGAGTTGGTTAACCATGCCCTCCTGCTCTTCAAATCAGCTTCTGTTGAGAAAGGCTTTGATTTCCAACTCCTAGTCTTCTGAATTTACTTAATATATACAATCATTATGCACACAGACATCAATGAGGCAAGTTGGTCAAAAACATTGTATTCTGTGTATTACCTTTTCAGTATAAAGTTATTACTATAAGAAATGCCTTCAGCTCACTTTTATGCTCCTCAATCTTCTCGCAGATGGTTCGTCTGATTAGACATTCTGTTCGTTTCACTTTCTCCTCTTCTGCTTCAGGCAAAGTTTCGTTCAGGGTACCATAGATGTCCGCTGCTTCCCGTGGGGACAAAAAATCCAGGTTGCAAGCACAGGCAATATAGTGTTTCTTCCAGGCACCATATTCGTTGTCAGATGTTCCATAGGTGAGGAACCAACCCTGTCGAATACACTTTGGAGCCCACAGGCAAT

Function

symbol description
ect2l Predicted to enable guanyl-nucleotide exchange factor activity. Predicted to be involved in regulation of catalytic activity.

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU202378 True 533 lncRNA 0.42 1 24317534 24318066

Neighbor

gene id symbol gene type direction distance location
zgc:162964 NA coding upstream 10516 24295606 ~ 24307018 (+)
xdh xdh,LOC107592779,LOC107733164,LOC107752765,LOC107594783 coding upstream 34911 24252861 ~ 24282623 (+)
dnajc27 dnajc27,LOC107752776,LOC107733160 coding upstream 70644 24238657 ~ 24246890 (+)
pomca pomc coding upstream 82409 24233358 ~ 24235125 (+)
ctsba ctsb,LOC108433939,LOC107733172,LOC107592770,LOC107752788 coding upstream 319492 23988758 ~ 23998042 (+)
LOC113534014 snap23.1,LOC108270295,LOC107697784,LOC107752778,LOC108433924 coding downstream 15459 24333525 ~ 24346184 (+)
rin3 LOC108270235 coding downstream 29036 24347102 ~ 24358534 (+)
pth2 pth2 coding downstream 43753 24361819 ~ 24363880 (+)
cdk1 cdk1,LOC107671106,LOC107717073 coding downstream 94905 24412971 ~ 24418924 (+)
trnah-gug_12 NA coding downstream 108703 24426769 ~ 24426840 (+)
G171019 NA non-coding upstream 7568 24309630 ~ 24309966 (+)
G171017 NA non-coding upstream 9205 24307854 ~ 24308329 (+)
G170904 NA non-coding upstream 281363 24035784 ~ 24036171 (+)
LOC117598313 NA non-coding upstream 283472 24028325 ~ 24034062 (+)
G170893 LOC108269891,LOC108433938,LOC105908308,LOC105908357,LOC107592771,LOC107752785,LOC107674111,LOC107733184 non-coding upstream 306185 24010349 ~ 24011349 (+)
G171135 smndc1 non-coding downstream 127537 24445603 ~ 24450067 (+)
G171121 NA non-coding downstream 167262 24485328 ~ 24491209 (+)
G171215 NA non-coding downstream 441546 24759612 ~ 24800058 (+)
G171352 nid2,wu:fb77a09,LOC107564977 non-coding downstream 754680 25072746 ~ 25076475 (+)
G171413 NA non-coding downstream 816534 25134600 ~ 25134885 (+)
LOC113533992 gphna,gphn,LOC108270253,LOC108443923,LOC107752769,LOC107657705,LOC107733155 other upstream 1295139 22861807 ~ 23022395 (+)
G169692 LOC107990201 other upstream 2497475 21819281 ~ 21820059 (+)
im:7136021 LOC108270035 other upstream 2551161 21760771 ~ 21766373 (+)
G169577 heatr5a,LOC108412624 other upstream 2643073 21669907 ~ 21674461 (+)
LOC113530103 LOC108269986 other upstream 3786312 20521595 ~ 20531222 (+)
kdm1a kdm1a other downstream 145400 24463466 ~ 24482854 (+)
cx28.6 LOC108269818,LOC108441857,LOC101482426,LOC102791942,LOC102199391,LOC100705227,LOC102313633,LOC107679991 other downstream 676427 24994493 ~ 25000619 (+)
G171329 NA other downstream 685917 25003983 ~ 25007766 (+)
LOC117598238 LOC108191637 other downstream 858308 25176374 ~ 25177897 (+)
samd4a samd4a other downstream 940745 25258811 ~ 25318277 (+)

Expression


Co-expression Network