G203577 (smg1)


Basic Information

Item Value
gene id G203577
gene name smg1
gene type non-coding
species striped catfish (Pangasianodon hypophthalmus)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_047607.1
NCBI id CM018553.1
chromosome length 26458119
location 980372 ~ 981015 (-)
genome version GENO_Phyp_1.0_2019_striped_catfish_Genome

Sequence

>TU241118
AAGTTCTGACCTGTTTGAACGGAACCCAGCTGTTAGCAGGGTTGGCCGGGTTCTGCGGGTTCCTCAGTCGCTCCAGAGCGTTGTGAATGGCGTCTCCGTACGTCTCCTGGAACCACGTCTCGTGAGGCGTCTCTGCGGCGGCGGCAGTGATGCTGCGCACGTGATCCAGAGCGAAGACTACGGGCCGCATCAGGGCCGAGTGTTTCTCCCTCATGATGGCCACCTTCTCCTCCCTGAAACACCGCACCACGGGTCAGAGGAACATCTCTACCACCACACAGC

Function

symbol description
smg1 Predicted to enable protein serine/threonine kinase activity. Predicted to be involved in TORC1 signaling and negative regulation of macroautophagy. Predicted to act upstream of or within nuclear-transcribed mRNA catabolic process, nonsense-mediated decay and phosphorylation. Predicted to be part of TORC1 complex and TORC2 complex. Predicted to be active in nucleus. Orthologous to human SMG1 (SMG1 nonsense mediated mRNA decay associated PI3K related kinase).

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU241118 True 282 lncRNA 0.60 2 980372 981015

Neighbor

gene id symbol gene type direction distance location
clec19a clec19a,LOC107658453,LOC107583104 coding downstream 48466 920007 ~ 931906 (-)
si:ch73-248e21.5 NA coding downstream 335786 642509 ~ 644586 (-)
si:ch73-248e21.7 NA coding downstream 341165 635684 ~ 639207 (-)
tspan4b LOC108280533,LOC107729542,LOC107658498,LOC108427360 coding downstream 349661 622345 ~ 630711 (-)
LOC113525013 NA coding downstream 366186 611190 ~ 614186 (-)
LOC113528078 cox6a2,LOC108280912,LOC107564019,LOC103367329,LOC107583062,LOC107658449 coding upstream 75355 1056370 ~ 1061679 (-)
LOC113528610 LOC108280679 coding upstream 130494 1111509 ~ 1119731 (-)
LOC117598757 LOC108280700,LOC108280715,LOC108280689,LOC108280710,LOC108280734 coding upstream 140151 1121166 ~ 1126092 (-)
LOC113528091 LOC108280723 coding upstream 162930 1143945 ~ 1148157 (-)
LOC117598761 NA coding upstream 167580 1148595 ~ 1150039 (-)
G203564 smg1 non-coding downstream 23748 954684 ~ 956624 (-)
LOC117598764 NA non-coding downstream 40029 939508 ~ 940343 (-)
G203545 NA non-coding downstream 66811 911956 ~ 913561 (-)
G203543 NA non-coding downstream 77040 903037 ~ 903332 (-)
G203513 NA non-coding downstream 95960 817570 ~ 884412 (-)
G203559 LOC108280785 non-coding upstream 60476 1041491 ~ 1043647 (-)
G203609 NA non-coding upstream 130072 1111087 ~ 1111312 (-)
G203630 NA non-coding upstream 257149 1238164 ~ 1241189 (-)
G203739 NA non-coding upstream 474172 1455187 ~ 1457398 (-)
G203733 NA non-coding upstream 518005 1499020 ~ 1500815 (-)
G203544 NA other downstream 69144 910117 ~ 911228 (-)
LOC117598979 NA other downstream 226550 750063 ~ 753822 (-)
G203488 NA other downstream 229573 741244 ~ 750799 (-)
LOC117598978 NA other downstream 229914 739668 ~ 750458 (-)
G203254 NA other downstream 490641 486222 ~ 489731 (-)
LOC113528609 LOC108280700,LOC108280715,LOC108280710,LOC108280689,LOC108280734 other upstream 145669 1126684 ~ 1130550 (-)
G203695 LOC108427335,LOC107658445,LOC107729508,LOC103035240,LOC107674167,LOC107732842,LOC107563993 other upstream 284647 1265662 ~ 1345171 (-)
LOC113527889 LOC108278777 other upstream 1010158 1991173 ~ 2013251 (-)
LOC113528455 LOC108278793,LOC108434931,LOC107551147,LOC107729474 other upstream 1084873 2065888 ~ 2077477 (-)
ifi35 ifi35 other upstream 1131430 2112445 ~ 2195540 (-)

Expression


Co-expression Network