G206722 (hcrt)


Basic Information

Item Value
gene id G206722
gene name hcrt
gene type non-coding
species striped catfish (Pangasianodon hypophthalmus)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_047607.1
NCBI id CM018553.1
chromosome length 26458119
location 6550891 ~ 6551152 (+)
genome version GENO_Phyp_1.0_2019_striped_catfish_Genome

Sequence

>TU244777
GCTGCATCAGGTATTTCAGTGGTCTTTCGAGGTCCAGTTTAACGGCTGTGTGAACGGTACCGAGTCCGCTCTCTGCGCCTCTCTTGCCCATAGTAAGGATCCCCGCAGCCTGGTTGCGCGAGCTGTGCAGAAGATGCTGCAGTCGGTCCTGGTACCGGCTTTCGGTCGCTTTCCGCTTGCCGAGTGTGAGGATCCCGGCGGCGGCGTCGCTGCTCAGGCGGCCCAGTTTCCCGTCCGGGTCGGTGAGGTTCCGGTGTCCCGC

Function

symbol description
hcrt Predicted to enable neuropeptide hormone activity; type 1 hypocretin receptor binding activity; and type 2 hypocretin receptor binding activity. Acts upstream of or within several processes, including circadian sleep/wake cycle, wakefulness; multicellular organismal response to stress; and sleep. Predicted to be located in endoplasmic reticulum. Predicted to be active in perinuclear region of cytoplasm. Is expressed in brain; female organism; hypocretin-secreting neurons; male organism; and spinal cord. Human ortholog(s) of this gene implicated in narcolepsy. Orthologous to human HCRT (hypocretin neuropeptide precursor).

NR:

description
protein NLRC3-like

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU244777 True 262 lncRNA 0.63 1 6550891 6551152

Neighbor

gene id symbol gene type direction distance location
nkiras2 nkiras2,LOC107687022,LOC107590605,LOC107729182,LOC107755561 coding upstream 204507 6343263 ~ 6346384 (+)
si:ch73-141c7.1 LOC108258527 coding upstream 274180 6271135 ~ 6276711 (+)
hsd17b1 hsd17b1 coding upstream 282893 6264199 ~ 6267998 (+)
rabep2 rabep2 coding upstream 328845 6215286 ~ 6222046 (+)
LOC113528207 NA coding upstream 338351 6205540 ~ 6212540 (+)
aspdh aspdh coding downstream 342079 6893231 ~ 6898472 (+)
pold1 pold1,LOC107653418,LOC107731044 coding downstream 367855 6919007 ~ 6936540 (+)
eps8l1a LOC108258326 coding downstream 455996 7007148 ~ 7019641 (+)
LOC117598990 LOC108258307 coding downstream 469319 7020471 ~ 7045978 (+)
LOC117599002 NA coding downstream 476623 7027775 ~ 7033434 (+)
G206540 NA non-coding upstream 41662 6483679 ~ 6509229 (+)
G206339 plcd3,plcd3a,LOC108432051,LOC107674588,LOC107581738 non-coding upstream 558819 5990607 ~ 5992072 (+)
G206291 NA non-coding upstream 586810 5937248 ~ 5964081 (+)
G206301 LOC108257121 non-coding upstream 606459 5940879 ~ 5944432 (+)
G206289 NA non-coding upstream 625706 5918445 ~ 5925185 (+)
G206801 NA non-coding downstream 138304 6689456 ~ 6737847 (+)
G206835 ptrf non-coding downstream 179533 6730685 ~ 6810353 (+)
G206942 NA non-coding downstream 347690 6898842 ~ 6931386 (+)
G206955 NA non-coding downstream 379168 6930320 ~ 7002168 (+)
G207025 NA non-coding downstream 503234 7054386 ~ 7058819 (+)
LOC117598831 LOC106607284,LOC108262339,LOC108259095,LOC108259092,LOC108441610 other upstream 290034 6252344 ~ 6260857 (+)
ypel3 ypel3,ypela,LOC108259066,LOC103040367,LOC108411043,LOC103393221,LOC105012807,LOC107686999,LOC107590566,LOC106600728 other upstream 355927 6180096 ~ 6194964 (+)
mapk3 mapk3,LOC108256206,LOC108411041,LOC107567791,LOC107690275,LOC107686994 other upstream 375525 6160334 ~ 6175366 (+)
si:ch211-198p11.6 LOC108276725 other upstream 416319 6130780 ~ 6134572 (+)
tmem98 tmem98,LOC107674611,LOC107738157,LOC107654470,LOC107720031 other upstream 652691 5889552 ~ 5898200 (+)
eftud2 eftud2,LOC107690313,LOC107731090,LOC107653466 other downstream 533289 7084441 ~ 7102215 (+)
LOC113528597 gjc1,LOC108412533,LOC107754260,LOC107731105,LOC107567456,LOC107653474,LOC107570945,LOC107690314 other downstream 557026 7108178 ~ 7131967 (+)
spsb3a spsb3,spsb3a,LOC107689049 other downstream 758055 7309207 ~ 7321965 (+)
G207480 LOC107834952 other downstream 1302039 7853191 ~ 7853509 (+)
trnas-cga_1 NA other downstream 1457034 8008186 ~ 8008411 (+)

Expression


Co-expression Network