G208701 (dxo,LOC107752708,LOC107666098,LOC107691245,LOC107743041)


Basic Information

Item Value
gene id G208701
gene name dxo,LOC107752708,LOC107666098,LOC107691245,LOC107743041
gene type non-coding
species striped catfish (Pangasianodon hypophthalmus)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_047607.1
NCBI id CM018553.1
chromosome length 26458119
location 10225583 ~ 10226503 (+)
genome version GENO_Phyp_1.0_2019_striped_catfish_Genome

Sequence

>TU247238
AAAAAATAAGGCTTAAATCCAGTTTTGAGGCACACCTGTGAAAGTTACTGCGCTGTTTCGGGGTGCAGATTTCAGCTGAGGTCTTTAGCTCGACGTAGCAGGCCGGAGCTGGAGGAGCTCTAGGGTCCTTATCTCGGCAGTCCACCTCACCAGAGAACAGTAGCTTATGGTCTGCTAGGCGAGTCTGGACTACTGTGCAGAAAGCCTCGTTTGTGTTGACAACCCCTCCTCGGTCTGGGACACCGTTCACATCTGCACAGATGTACTGCTCAAACTTGTAGCCCCAGTACATCATCTCCTCATGCCTCTCTGTACGGTTCTCTCGGTTAACTCGGGCAGCCTCTGTCTCCACTTCGCTCATGTAGAGAGTGCCTCTGAACTTGGACACAGCCAGCAACCATCCCTCCTGCGTCTCATACGGAGTGGTCAACAGCTTCGTTAAGTGGCCTCGCCAAGTGACAAAGTCTACACCTAGTGT

Function

symbol description
dxo Predicted to enable several functions, including bis(5'-nucleosyl)-tetraphosphatase activity; metal ion binding activity; and nucleotide binding activity. Predicted to be located in nucleus. Orthologous to human DXO (decapping exoribonuclease).

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU247238 True 478 lncRNA 0.52 2 10225583 10226503

Neighbor

gene id symbol gene type direction distance location
LOC113528384 slc25a17,LOC108412891,LOC106601749,LOC107666095,LOC107743042,LOC107548713 coding upstream 2709 10215045 ~ 10222874 (+)
LOC113528352 snu13,snu13b,LOC103040872,LOC101154660,LOC105910236 coding upstream 30377 10192804 ~ 10195206 (+)
casc3 casc3 coding upstream 299380 9917962 ~ 9926203 (+)
msl1a msl1 coding upstream 308482 9912768 ~ 9917101 (+)
si:dkey-225f5.4 LOC108258433 coding upstream 332087 9886784 ~ 9893496 (+)
helz helz,LOC107691233,LOC107665819 coding downstream 72384 10298887 ~ 10341715 (+)
lmtk2 lmtk2 coding downstream 199556 10426059 ~ 10448685 (+)
bri3 bri3 coding downstream 248851 10475354 ~ 10484206 (+)
fam20ca LOC108274115,LOC108412745,LOC107713951,LOC107584184 coding downstream 521643 10748146 ~ 10798178 (+)
LOC113528286 rai1 coding downstream 582951 10809454 ~ 10846584 (+)
G208700 NA non-coding upstream 4044 10221283 ~ 10221539 (+)
G208488 col1a1a,LOC108279263,LOC107585052,LOC107740634 non-coding upstream 163618 10039409 ~ 10061965 (+)
G208504 NA non-coding upstream 342456 9864977 ~ 9883127 (+)
G208507 NA non-coding upstream 366701 9846084 ~ 9858882 (+)
G208472 NA non-coding upstream 477573 9746285 ~ 9748010 (+)
G208783 NA non-coding downstream 115405 10341908 ~ 10342224 (+)
G208911 NA non-coding downstream 600522 10827025 ~ 10828913 (+)
G208916 NA non-coding downstream 628652 10855155 ~ 10857015 (+)
G209067 NA non-coding downstream 705556 10932059 ~ 10932428 (+)
G209069 tbl3,LOC107724722,LOC106601810 non-coding downstream 716752 10943255 ~ 10947541 (+)
rapgefl1 rapgefl1,LOC107717207,LOC107662398,LOC107740631,LOC107667751,LOC107585050,LOC106600822 other upstream 237810 9944306 ~ 9987773 (+)
nupr1b nupr1,LOC108413333,LOC107660958,LOC107739393,LOC107567154,LOC100692788,LOC103393451 other upstream 1162170 9061563 ~ 9063413 (+)
asphd1 asphd1,LOC107568490,LOC107755186,LOC107552472,LOC107739384 other upstream 1267483 8950466 ~ 8958100 (+)
trnas-cga_1 NA other upstream 2217172 8008186 ~ 8008411 (+)
G207480 LOC107834952 other upstream 2372074 7853191 ~ 7853509 (+)
G208781 cacng4b,LOC108259704,LOC106606650,LOC107565862,LOC107691234,LOC106601773,LOC107724746,LOC107713946 other downstream 122899 10349402 ~ 10781459 (+)
cdc42ep4a LOC108256079,LOC108432235,LOC103033379 other downstream 1053577 11280080 ~ 11388020 (+)
luc7l3 luc7l3,LOC107674472,LOC107726809,LOC107654661 other downstream 1340616 11567119 ~ 11577823 (+)
tbc1d16 tbc1d16,LOC107559246,LOC107689993,LOC107670685,LOC107562324 other downstream 1822904 12049407 ~ 12086058 (+)
LOC113528416 LOC108275780 other downstream 1908766 12135269 ~ 12140371 (+)

Expression


Co-expression Network