G209529


Basic Information

Item Value
gene id G209529
gene name NA
gene type non-coding
species striped catfish (Pangasianodon hypophthalmus)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_047607.1
NCBI id CM018553.1
chromosome length 26458119
location 11388960 ~ 11389231 (-)
genome version GENO_Phyp_1.0_2019_striped_catfish_Genome

Sequence

>TU248181
GGTATCCTAATTAAGGAGGTTTATGTGACTCCCATCTACATCAGCAGTAAAGGTGATGCTGAACGGTCATGAACAGGAAGCTCCCTCAGGCTCTCCAGCCACTCTGCTCCCAGTCTAATGAGGGATCGTCACATCAGATTTGCACTTAAGAGCTAAGCAAGGGCAGTACTCCCCCACCACTGAGTGGGGTCACCCCTCCCCCAGGCCTCACTCACTCCTCGGAGGAACCGGGAGCAGCTTCGGGTGGAGGTAAGATTGTTGTCAGGGCCACA

Function

NR:

description
leucine-rich repeat and immunoglobulin-like domain-containing nogo receptor-interacting protein 2 isoform X2

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU248181 True 272 lncRNA 0.54 1 11388960 11389231

Neighbor

gene id symbol gene type direction distance location
ttyh2l LOC108277373,LOC108432236 coding downstream 197445 11154915 ~ 11191515 (-)
LOC113528317 chmp6,LOC108277388,LOC108432238,LOC106606311,LOC105939499 coding downstream 236797 11147394 ~ 11152163 (-)
baiap2a LOC108277336,LOC108432239,LOC107711237,LOC107672452,LOC107670476 coding downstream 243128 11074517 ~ 11145832 (-)
LOC113528015 NA coding downstream 363156 11023672 ~ 11025804 (-)
rcvrna LOC108260894,LOC108412638,LOC107583783,LOC107725264,LOC107690016,LOC107555668,LOC107755173 coding downstream 377410 11009287 ~ 11011550 (-)
hs3st3b1a si:ch211-216b21.2,hs3st3a1,LOC108260710,LOC107704231,LOC107684140,LOC107753271 coding upstream 37054 11426285 ~ 11438335 (-)
LOC113528663 NA coding upstream 43279 11432510 ~ 11432628 (-)
LOC113528102 rnf222 coding upstream 104044 11493275 ~ 11495487 (-)
LOC113528402 LOC108258929 coding upstream 120500 11509731 ~ 11518087 (-)
slc16a5b LOC108274816 coding upstream 131535 11520766 ~ 11529442 (-)
LOC113528410 NA non-coding downstream 167582 11218659 ~ 11221378 (-)
G209189 NA non-coding downstream 243976 11089013 ~ 11144984 (-)
G208998 NA non-coding downstream 754810 10633535 ~ 10634150 (-)
G208980 NA non-coding downstream 870013 10518342 ~ 10518947 (-)
G208964 lmtk2 non-coding downstream 938420 10447736 ~ 10450540 (-)
G209538 NA non-coding upstream 11491 11400722 ~ 11401423 (-)
G209541 LOC108256081 non-coding upstream 13847 11403078 ~ 11476796 (-)
G209553 atp5h,LOC103042933,LOC101487002,LOC107599347 non-coding upstream 142345 11531576 ~ 11535697 (-)
G209618 NA non-coding upstream 211241 11600472 ~ 11601244 (-)
G209624 NA non-coding upstream 221403 11610634 ~ 11617188 (-)
tecpr1b LOC108276900 other downstream 918442 10450724 ~ 10470518 (-)
hoxb8a hoxb8a,LOC108278530,LOC108413053,LOC103044850,LOC107582957,LOC107662386,LOC107585089 other downstream 1656394 9729851 ~ 9732566 (-)
copz2 copz2,LOC108260256,LOC108413159,LOC107740614,LOC107662379,LOC107710054,LOC107585036,LOC107687783,LOC105013247,LOC108246742,LOC106527321,LOC106912034 other downstream 1914482 9464331 ~ 9474478 (-)
prr15la LOC108273894,LOC108412372 other downstream 1969376 9409804 ~ 9419584 (-)
dnal4a dnal4,LOC108261343,LOC108412416,LOC108436609,LOC106591471 other downstream 2185320 9196496 ~ 9203640 (-)
hmox1a hmox1,LOC108432221 other upstream 252926 11642157 ~ 11647997 (-)
zgc:162612 foxd1,LOC108278341,LOC107757501 other upstream 310618 11699849 ~ 11701172 (-)
LOC113528332 hs3st6,LOC102795972 other upstream 908545 12297776 ~ 12315498 (-)
msrb1a msrb1 other upstream 944623 12333854 ~ 12339269 (-)
tom1 LOC108260160 other upstream 1157102 12546333 ~ 12559213 (-)

Expression


Co-expression Network