G210789 (xylt2)


Basic Information

Item Value
gene id G210789
gene name xylt2
gene type non-coding
species striped catfish (Pangasianodon hypophthalmus)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_047607.1
NCBI id CM018553.1
chromosome length 26458119
location 13862372 ~ 13862879 (+)
genome version GENO_Phyp_1.0_2019_striped_catfish_Genome

Sequence

>TU249716
TGCTGTGTGCAGTACTGAGGTAAAGCCTGTGGCATCAGCTCTCCAGCCTGGTGCTTGCATACGATATTGGCGATCTCCTGCCGGCACTGGCGTGATCCAGCACGGTGCAGAGCCGACAGTGCATCCTTCCCGACGATGTCACAGCTGGGCACAAAGTCGTTGCTCGGGACCTGAGGTGCGCCGTCGACGCTCCCCGGTTCTCCTTGAGCGCCTGCTGGGAATTTTCCTCCTTCCTGCCCCTTCATATCGGTGAAGTTACGGCTGCTGGATGGATCGTACGGGGCGATGGCATCTACAGCTCCAATGCCCTGCACCACTCCGGCTCCTTCTGTCCTGGAGGGCTTCATTCTTCGTTTTCCCCCTTTCCTGTGGGGACGAGTGACAACAGGCCGCTCCAGGTCATGTTTCCCCCGGCCATGGTAACCCCCGGACAGAGCATTCTGCCCCCTGGCTTCTGAGTCTCTCCTCACATCCTGGTTGTTGTGATCAGGCAGCTTAGACCGCCGCT

Function

symbol description
xylt2 Predicted to enable protein xylosyltransferase activity. Predicted to be involved in chondroitin sulfate proteoglycan biosynthetic process and heparan sulfate proteoglycan biosynthetic process. Predicted to act upstream of or within proteoglycan biosynthetic process. Predicted to be located in Golgi membrane. Human ortholog(s) of this gene implicated in pseudoxanthoma elasticum. Orthologous to human XYLT2 (xylosyltransferase 2).

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU249716 True 508 lncRNA 0.59 1 13862372 13862879

Neighbor

gene id symbol gene type direction distance location
dhps dhps,LOC107563249,LOC107661880 coding upstream 128156 13721234 ~ 13734216 (+)
fbxw9 fbxw9 coding upstream 148488 13702684 ~ 13713884 (+)
nfixb nfix,nfixb,LOC107553634,LOC107661654,LOC107715650,LOC106601192,LOC107718575 coding upstream 202133 13517596 ~ 13660239 (+)
tspan35 tspan16 coding upstream 403642 13448249 ~ 13458730 (+)
epor epor coding upstream 432174 13424701 ~ 13430198 (+)
si:ch73-364h19.1 LOC108258115 coding downstream 14281 13877160 ~ 13889327 (+)
si:ch211-120g10.1 si:ch211-120g10.1,si:ch73-364h19.2,LOC108279991,LOC108435881,LOC107558873,LOC107548722,LOC107748865,LOC107665693,LOC107654584 coding downstream 30592 13893471 ~ 13903111 (+)
cdr2l cdr2l,LOC107743016,LOC107665638 coding downstream 82486 13945365 ~ 13960351 (+)
nptx1l nptx1l,LOC108274797,LOC108435874,LOC107569544,LOC107665615,LOC107684232 coding downstream 255074 14117953 ~ 14122314 (+)
LOC113528345 mgat5b,LOC108274344,LOC108435872,LOC107743022,LOC107562046 coding downstream 366943 14229822 ~ 14311551 (+)
G210782 NA non-coding upstream 1142 13861008 ~ 13861230 (+)
G210779 xylt2,LOC107665700,LOC107548721 non-coding upstream 6577 13855143 ~ 13855795 (+)
G210778 NA non-coding upstream 8115 13852844 ~ 13854257 (+)
G210699 xylt2,LOC108412257 non-coding upstream 17801 13842973 ~ 13844571 (+)
G210725 NA non-coding upstream 117844 13743449 ~ 13744528 (+)
G210792 NA non-coding downstream 7491 13870370 ~ 13871092 (+)
G210788 NA non-coding downstream 46230 13909109 ~ 13962386 (+)
LOC113528277 NA non-coding downstream 59994 13922873 ~ 13927989 (+)
G210784 NA non-coding downstream 124996 13987875 ~ 13989893 (+)
G211006 NA non-coding downstream 515664 14378543 ~ 14379897 (+)
zgc:158403 zgc:158403,LOC108258290,LOC108441004,LOC107718630,LOC107553678,LOC107661656,LOC107695678 other upstream 368430 13464085 ~ 13493942 (+)
znf653 znf653,LOC104961106,LOC107553636,LOC103393609 other upstream 416686 13435381 ~ 13445686 (+)
ndufb10 ndufb10 other upstream 1488000 12367566 ~ 12374372 (+)
arhgap17b LOC108279379,LOC108432202 other upstream 1672302 12158703 ~ 12190070 (+)
LOC113528416 LOC108275780 other upstream 1722001 12135269 ~ 12140371 (+)
socs3a socs3 other downstream 756325 14619204 ~ 14621788 (+)
LOC117598752 NA other downstream 1125207 14988086 ~ 14991450 (+)
G211913 NA other downstream 2055338 15918217 ~ 15968759 (+)
LOC113527983 sstr5,sstr2,LOC108260271,LOC103373483,LOC107083133,LOC104918336,LOC102291375 other downstream 2277451 16140330 ~ 16146326 (+)
srl srl,LOC108261333,LOC107695714,LOC107661647,LOC107718567,LOC107553668 other downstream 3224405 17087284 ~ 17113156 (+)

Expression


Co-expression Network