rps11 (rps11,LOC107674708)


Basic Information

Item Value
gene id rps11
gene name rps11,LOC107674708
gene type coding
species striped catfish (Pangasianodon hypophthalmus)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_047607.1
NCBI id CM018553.1
chromosome length 26458119
location 5089263 ~ 5091817 (+)
genome version GENO_Phyp_1.0_2019_striped_catfish_Genome

Sequence

>XM_026917205.2
TATACTTTAGGGCCGCCTTTAGTTTGCGTCACTTCCGGTTGCACGGCTCTTCCGTCTGTCTCGCGCATGTGTAGTTCTCTTTACGACTCGGCTGGCAAAGATGGCGGACACTCAGAATGAAAGGGCTTATCAAAAGCAGCCCACCATCTTCCAGAACAAAAAGCGAGTACTGGTCAGTGAAACGGGTGCCAAAGAGAAGCTCCCACGTTATCACCGAAATGTTGGTCTAGGCTTCAAAACCCCCAGAGAGGCTATTGAAGGCACTTACATTGACAAAAAATGTCCCTTTACTGGTAATGTGTCCATCAGAGGCCGTATTCTGTCTGGTGTGGTGACCAAGATGAAGATGCAGAGGACCATCGTCATCAGACGTGATTACCTGCACTACATCCGCAAGTACAACCGTTTTGAGAAGAGGCACAAGAACATGTCTGTCCACCTCTCTCCCTGCTTCAGGGACGTGACTGTGGGTGACATCGTCACTGTTGGAGAGTGCAGACCCCTCAGCAAGACTGTGAGGTTCAACGTGCTGAAGGTCACCAAAGCAGCAGGAGCCAAGAAACAATTCCAGAAGTTTTAAAGCTGTTTGCTGAACATTTTCTGGGTTCCGCTGTATTGCCATGACTTTTGGAAGTGAAATTAAATCTGTTCTTTAAATCTG

Function

symbol description
rps11 Predicted to be a structural constituent of ribosome. Predicted to act upstream of or within translation. Predicted to be located in ribosome. Predicted to be part of cytosolic small ribosomal subunit. Orthologous to human RPS11 (ribosomal protein S11).

NR:

description
PREDICTED: 40S ribosomal protein S11

GO:

id name namespace
GO:0006412 translation biological_process
GO:0022627 cytosolic small ribosomal subunit cellular_component
GO:0003735 structural constituent of ribosome molecular_function

KEGG:

id description
K02949 RP-S11e, RPS11; small subunit ribosomal protein S11e

RNA

RNA id representative length rna type GC content exon number start site end site
XM_026917205.2 True 661 mRNA 0.48 5 5089263 5091817

Neighbor

gene id symbol gene type direction distance location
map3k14a LOC108259239 coding upstream 10893 5057922 ~ 5078370 (+)
wnt9b wnt9b,LOC108259511,LOC107721476,LOC108427420,LOC107601233 coding upstream 98012 4982026 ~ 4991251 (+)
LOC113528572 NA coding upstream 114433 4970822 ~ 4974830 (+)
fmnl1a LOC108278868,LOC107654518,LOC107601298,LOC107721528,LOC108427416,LOC107720013 coding upstream 318767 4737041 ~ 4770496 (+)
ezh1 ezh1 coding upstream 539785 4527593 ~ 4549478 (+)
hrob LOC108259294 coding downstream 4505 5096322 ~ 5103874 (+)
asic2 asic2,LOC108411330,LOC107654528,LOC107674665,LOC107720021,LOC107737939 coding downstream 16604 5108421 ~ 5626980 (+)
kcnj19a si:dkey-106c17.3,LOC108274233,LOC108432058,LOC107581800,LOC107654469,LOC107737881,LOC107674737 coding downstream 696904 5788721 ~ 5824200 (+)
LOC113528511 NA coding downstream 932479 6024296 ~ 6025839 (+)
zgc:100868 NA coding downstream 1027676 6119493 ~ 6128811 (+)
G205454 NA non-coding upstream 8059 5079987 ~ 5081204 (+)
G205436 NA non-coding upstream 91467 4894540 ~ 4997796 (+)
LOC117598842 NA non-coding upstream 163581 4923914 ~ 4925682 (+)
G205315 NA non-coding upstream 416234 4671760 ~ 4673029 (+)
G205306 NA non-coding upstream 525609 4563408 ~ 4563654 (+)
G206157 NA non-coding downstream 537641 5629458 ~ 5629659 (+)
G206212 NA non-coding downstream 643553 5735370 ~ 5735607 (+)
G206221 NA non-coding downstream 663035 5754852 ~ 5756939 (+)
LOC117599005 NA non-coding downstream 777045 5868862 ~ 5869806 (+)
G206289 NA non-coding downstream 826628 5918445 ~ 5925185 (+)
gosr2 gosr2,LOC107654523,LOC102776032,LOC106601130 other upstream 74747 5003548 ~ 5014516 (+)
psmc3ip psmc3ip other upstream 367795 4712873 ~ 4721468 (+)
retreg3 fam134c other upstream 377947 4692477 ~ 4711316 (+)
plekhh3 plekhh3,LOC107601293,LOC107720008,LOC107688129 other upstream 418617 4620218 ~ 4670646 (+)
trnae-cuc_26 NA other upstream 1118013 3971179 ~ 3971250 (+)
G206166 NA other downstream 565795 5657612 ~ 5660848 (+)
tmem98 tmem98,LOC107674611,LOC107738157,LOC107654470,LOC107720031 other downstream 797735 5889552 ~ 5898200 (+)
si:ch211-198p11.6 LOC108276725 other downstream 1038963 6130780 ~ 6134572 (+)
mapk3 mapk3,LOC108256206,LOC108411041,LOC107567791,LOC107690275,LOC107686994 other downstream 1068517 6160334 ~ 6175366 (+)
ypel3 ypel3,ypela,LOC108259066,LOC103040367,LOC108411043,LOC103393221,LOC105012807,LOC107686999,LOC107590566,LOC106600728 other downstream 1088279 6180096 ~ 6194964 (+)

Expression


Co-expression Network