G75893 (col6a3,LOC108262369,LOC106600155)


Basic Information

Item Value
gene id G75893
gene name col6a3,LOC108262369,LOC106600155
gene type unknown
species striped catfish (Pangasianodon hypophthalmus)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_047599.1
NCBI id CM018545.1
chromosome length 32114633
location 1797982 ~ 1803645 (-)
genome version GENO_Phyp_1.0_2019_striped_catfish_Genome

Sequence

>TU90050
AGGGTGGAGTGATGGGAACTGCCACAGCCTCTATAGAAGTCAGAAGTTGCTCTTGGACATTTGGGAGCTCAGTGAAATCTGACACGGTCAGAGCAAAACGGGGGCCAAATGAAATTCTCTCAAGTTCGTTGCTATCAGAGTCCCTTGTTCCTATTCCGAAAATCAAGATTCCCAGATCCTTCAGCGCCGAAGCTGGGATATCGACATTGTCAAACGACCTTCCGGCACTCAACAGGATCAGCATCTGTGGTACACCCTCCAGTCGTCTGCTACCCGAGGAGGCAGTAAATACGTTGTCTCTGACGTACTGTAGAGCTGCCCCTATGTTTAGGGGCCTTCCTCCTTTGTGCCTCAAAGCTCTGACTGTGCCAAGAAGGTCCTCCTTTGTTGTGTATGTCTTAAGATAGAAATGGATATCAGCATCTCTGCTGAACTGGACTACAGAAACACGGTC

Function

symbol description
col6a3 Predicted to enable serine-type endopeptidase inhibitor activity. Acts upstream of or within axon extension and motor neuron axon guidance. Predicted to be located in extracellular region. Predicted to be part of collagen trimer. Predicted to be active in collagen-containing extracellular matrix and extracellular space. Is expressed in head. Human ortholog(s) of this gene implicated in Ullrich congenital muscular dystrophy; dystonia 27; and muscular dystrophy. Orthologous to human COL6A3 (collagen type VI alpha 3 chain).

NR:

description
PREDICTED: collagen alpha-3(VI) chain isoform X1

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU90050 True 454 TUCP 0.49 2 1797982 1803645

Neighbor

gene id symbol gene type direction distance location
mlphb LOC108261129 coding downstream 50951 1723257 ~ 1747031 (-)
med4 med4,LOC107673119,LOC107709409,LOC107724027 coding downstream 173933 1615900 ~ 1624049 (-)
trnal-caa_7 NA coding downstream 229125 1568745 ~ 1568857 (-)
LOC113524666 LOC108271633 coding downstream 231195 1554942 ~ 1566787 (-)
si:dkey-230p4.1 LOC108271988 coding downstream 245547 1529825 ~ 1552435 (-)
cops8 cops8,LOC106581673,LOC107725246,LOC107723689,LOC107685920 coding upstream 54617 1858262 ~ 1871493 (-)
trim63b trim63b,LOC100194566,LOC100505419 coding upstream 58508 1862153 ~ 1863790 (-)
ranbp2 LOC108261082,LOC108440489 coding upstream 146487 1950132 ~ 1986039 (-)
lims2 LOC108261084,LOC108440488,LOC105898085 coding upstream 184895 1988540 ~ 1998073 (-)
LOC113546994 LOC108261078 coding upstream 265902 2069547 ~ 2080413 (-)
G75875 NA non-coding downstream 75183 1722581 ~ 1722799 (-)
G75814 NA non-coding downstream 141134 1656373 ~ 1656848 (-)
G75740 NA non-coding downstream 330083 1467662 ~ 1467899 (-)
G75739 NA non-coding downstream 342695 1454999 ~ 1455287 (-)
G75737 NA non-coding downstream 364755 1433022 ~ 1433227 (-)
G75880 NA non-coding upstream 45592 1849237 ~ 1873669 (-)
G75925 NA non-coding upstream 107551 1911196 ~ 1917438 (-)
G75926 NA non-coding upstream 109486 1913131 ~ 1925253 (-)
G75927 NA non-coding upstream 110372 1914017 ~ 1914729 (-)
G75947 NA non-coding upstream 142328 1945973 ~ 1946176 (-)
trnar-ucu_7 NA other downstream 123409 1674484 ~ 1674573 (-)
trnat-agu_8 NA other downstream 123797 1674112 ~ 1674185 (-)
trnar-ucu_6 NA other downstream 135373 1662520 ~ 1662609 (-)
trnat-agu_7 NA other downstream 147856 1650053 ~ 1650126 (-)
trnar-ucu_5 NA other downstream 159130 1638763 ~ 1638852 (-)
LOC113547075 slc5a7,LOC108440498,LOC106586545,LOC106582186,LOC107733037 other upstream 244134 2047779 ~ 2064298 (-)
ifngr2 NA other upstream 880863 2684508 ~ 2753806 (-)
LOC113541352 c6h21orf62 other upstream 997361 2801006 ~ 2805863 (-)
faima faima,LOC108266416,LOC108425966,LOC102793570,LOC107723686,LOC107567769,LOC101481285 other upstream 1983311 3786956 ~ 3816059 (-)
G77283 NA other upstream 3036315 4839960 ~ 4844879 (-)

Expression


Co-expression Network