G93638


Basic Information

Item Value
gene id G93638
gene name NA
gene type non-coding
species striped catfish (Pangasianodon hypophthalmus)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_047600.1
NCBI id CM018546.1
chromosome length 31307711
location 3735144 ~ 3735373 (+)
genome version GENO_Phyp_1.0_2019_striped_catfish_Genome

Sequence

>TU111280
aataaaccccagtgacccagttccattggcagccaaacatgcccatgccataacactgcctccacatgtttgacggatgatgtggtatactttggatcatgagcccttcctttccttctccatacttttctcttcccatcattctggtacaagttaatcttgcatcagaactggtcaggctttttttagaggtttttttagcaaagtctaatctggcctttgtgttcttg

Function

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU111280 True 230 lncRNA 0.43 1 3735144 3735373
Loading

Neighbor

gene id symbol gene type direction distance location
LOC113534758 LOC108264137,LOC108263991,LOC108264138,LOC108437990 coding upstream 17906 3706069 ~ 3717238 (+)
LOC113534759 LOC108264138,LOC108263991,LOC108264137,LOC108437990 coding upstream 39197 3687811 ~ 3695947 (+)
plch1 plch1,LOC107671075,LOC107748081,LOC102777008 coding upstream 47436 3608735 ~ 3687708 (+)
c18h3orf33 c4h3orf33 coding upstream 130313 3598375 ~ 3604831 (+)
slc33a1 slc33a1,LOC107711775,LOC107675614 coding upstream 138108 3584185 ~ 3597036 (+)
LOC113534756 LOC108263991,LOC108264137,LOC108264138,LOC108437990 coding downstream 9348 3744721 ~ 3757046 (+)
LOC113534740 LOC108264118,LOC108434085,LOC108434032 coding downstream 377633 4113006 ~ 4118694 (+)
LOC113534738 LOC108264112,LOC108264124,LOC108264111 coding downstream 417224 4152597 ~ 4157969 (+)
LOC113534614 LOC108264113,LOC108434035,LOC108264109,LOC108434067,LOC108264124,LOC108263989,LOC108434043,LOC108264108 coding downstream 429626 4164999 ~ 4168246 (+)
LOC113534720 LOC108264092,LOC108434071 coding downstream 867700 4603073 ~ 4618368 (+)
G93633 NA non-coding upstream 11452 3713343 ~ 3723692 (+)
G93475 NA non-coding upstream 133410 3600997 ~ 3601734 (+)
LOC113534301 NA non-coding upstream 399566 3333815 ~ 3335578 (+)
G93269 NA non-coding upstream 523008 3211887 ~ 3212136 (+)
G93213 NA non-coding upstream 666921 3066030 ~ 3068223 (+)
G93651 NA non-coding downstream 173464 3908837 ~ 3909071 (+)
G93696 NA non-coding downstream 359156 4094529 ~ 4094732 (+)
G93702 NA non-coding downstream 414340 4149713 ~ 4149923 (+)
G93704 NA non-coding downstream 419214 4154587 ~ 4155048 (+)
G93706 NA non-coding downstream 419885 4155258 ~ 4155559 (+)
G93421 NA other upstream 170518 3562353 ~ 3564626 (+)
ccnl1a ccnl1,ccnl1a,LOC107710830,LOC107691967 other upstream 500148 3225171 ~ 3234996 (+)
si:ch211-203b8.6 LOC108264315 other upstream 510429 3217361 ~ 3224715 (+)
LOC113534803 NA other upstream 1077017 2657030 ~ 2658127 (+)
G92757 NA other upstream 1549924 2184685 ~ 2185220 (+)
LOC113534398 LOC108264123,LOC108437981 other downstream 223139 3958512 ~ 3976681 (+)
G93685 NA other downstream 320858 4056231 ~ 4056738 (+)
G93703 LOC107747660 other downstream 418681 4154054 ~ 4154346 (+)
G93717 NA other downstream 448759 4184132 ~ 4184376 (+)
LOC113534605 gpr149 other downstream 975788 4711161 ~ 4729510 (+)

Expression

G93638 Expression in all Baseline Samples

Bar chart with 27 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 20.
End of interactive chart.

G93638 Expression in each Bioproject

Bar chart with 3 bars.
G93638 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 60.
End of interactive chart.

Co-expression Network