G135076


Basic Information

Item Value
gene id G135076
gene name NA
gene type non-coding
species striped catfish (Pangasianodon hypophthalmus)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_047602.1
NCBI id CM018548.1
chromosome length 30442583
location 18733398 ~ 18733630 (+)
genome version GENO_Phyp_1.0_2019_striped_catfish_Genome

Sequence

>TU159581
TCCAATTCTGTCAGCCTCTGGTGCAGTAACTGGGGTTTCTCATTTCTCAAGGTCAGTGCAAACTCTCATCTGAGAATCATACTGGAGGTCCATCAGCCCAAAACAAAGAAAGGTATGCTCAGTTTTCTGGGACTGATTAATTACTGCCACCAGTACATACCTGACTGTTCACATCACGACAAGGTGTTGCGCCAGTGCTGCCTCAAAGACTTGCCTGATGATATTGAATGGAC

Function

GO: NA

KEGG:

id description
ko04974 Protein digestion and absorption

RNA

RNA id representative length rna type GC content exon number start site end site
TU159581 True 233 lncRNA 0.46 1 18733398 18733630

Neighbor

gene id symbol gene type direction distance location
vgll4l LOC108265912 coding upstream 435917 18291489 ~ 18297481 (+)
dgcr6 dgcr6,LOC108265986,LOC103029434,LOC107721026,LOC108430318,LOC107572069 coding upstream 457930 18273663 ~ 18275468 (+)
rpl6 rpl6,LOC107699672,LOC107671003 coding upstream 474674 18252746 ~ 18258724 (+)
acaa2 acaa2,LOC107671002 coding upstream 481694 18241929 ~ 18251704 (+)
vsig8b LOC108265910 coding upstream 518255 18204157 ~ 18215143 (+)
lmx1bb lmx1b,lmx1bb,LOC108434405,LOC107723253,LOC107550585 coding downstream 409917 19143547 ~ 19200105 (+)
zbtb34 LOC108265239 coding downstream 512118 19245748 ~ 19264636 (+)
ralgps1 ralgps1,LOC108412534,LOC107669254,LOC107727327,LOC107723240 coding downstream 536996 19270626 ~ 19389662 (+)
LOC113533125 LOC108265174 coding downstream 665108 19398738 ~ 19404045 (+)
LOC117595725 LOC108265174 coding downstream 685120 19418750 ~ 19419938 (+)
LOC113533555 NA non-coding upstream 316966 18395861 ~ 18416432 (+)
LOC113533181 NA non-coding upstream 460548 18271945 ~ 18272850 (+)
LOC113533180 NA non-coding upstream 461634 18270496 ~ 18271764 (+)
G134655 NA non-coding upstream 611237 18121879 ~ 18122161 (+)
G134598 NA non-coding upstream 648919 18074135 ~ 18084479 (+)
G135085 NA non-coding downstream 78860 18812490 ~ 18812710 (+)
LOC113533586 NA non-coding downstream 136787 18870417 ~ 18873621 (+)
G135090 NA non-coding downstream 149738 18883368 ~ 18883781 (+)
G135101 NA non-coding downstream 215597 18949227 ~ 18955201 (+)
G135164 NA non-coding downstream 535704 19269334 ~ 19269668 (+)
pbx3b pbx3,pbx3b,LOC108434408,LOC107550583,LOC107669256,LOC107555108 other upstream 51466 18436185 ~ 18681932 (+)
vdac3 vdac3,LOC107754399,LOC107560056 other upstream 684509 18030975 ~ 18048889 (+)
G134341 NA other upstream 1436515 17296111 ~ 17296883 (+)
gucd1 gucd1,LOC102792582 other upstream 1864630 16859976 ~ 16868768 (+)
bicdl1 bicdl1,LOC107724381,LOC107699624 other upstream 1995414 16716133 ~ 16737984 (+)
G135287 LOC108265174 other downstream 753857 19487487 ~ 19502643 (+)
LOC113533656 gnas,LOC108261582,LOC108265241,LOC108434415,LOC104936173,LOC102796627 other downstream 1092168 19825798 ~ 19902367 (+)
LOC113533164 abracl,LOC107727609,LOC107558932,LOC107553474 other downstream 1447138 20180768 ~ 20185618 (+)
LOC113533440 erc2,LOC108264953 other downstream 1488785 20222415 ~ 20442191 (+)
selenok selenok,selk,LOC107750820,LOC107693600,LOC107594974 other downstream 2010950 20744580 ~ 20747856 (+)

Expression


Co-expression Network