G176991 (eif4g2,LOC108433007,LOC101472382,LOC103379577,LOC100694876,LOC102291832,LOC102792130)


Basic Information

Item Value
gene id G176991
gene name eif4g2,LOC108433007,LOC101472382,LOC103379577,LOC100694876,LOC102291832,LOC102792130
gene type non-coding
species striped catfish (Pangasianodon hypophthalmus)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_047605.1
NCBI id CM018551.1
chromosome length 26640196
location 6551325 ~ 6551582 (-)
genome version GENO_Phyp_1.0_2019_striped_catfish_Genome

Sequence

>TU209513
TGGCAGCATCTTCTGCATGTTGACCTTGCTCTGCTGGAACAAGTCAGTGAGCCATTCCTTATCCTTCAGCTTGGCTGTTTGCTGCAGACAAAGCAAGAAGAGAGGGAAGTGTATGCCGTTCTCCAGAGGATGGGCCAAGTCTGCGATGCTCATGAGCTCAGCGATGATGGCACGTGCAGCAAACTGGGCCAGATAGGACTTCACCAGGGGAATGTCACCCTCAAGCTTAGGACACTGGTCCAAAACGTTAAGGAAAGC

Function

symbol description
eif4g2 Enables translation initiation factor activity. Involved in several processes, including negative regulation of autophagy; positive regulation of cell growth; and regulation of translational initiation. Located in cytosol. Part of eukaryotic translation initiation factor 4F complex.

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU209513 True 258 lncRNA 0.52 1 6551325 6551582

Neighbor

gene id symbol gene type direction distance location
galnt18b galnt18,galnt18b,LOC107584699,LOC107686803,LOC106587200 coding downstream 89499 6358137 ~ 6461826 (-)
LOC113536569 LOC108271057,LOC108442067,LOC107741992,LOC107680499,LOC107657964 coding downstream 254449 6227094 ~ 6296876 (-)
LOC113536415 acyp2,LOC105896825 coding downstream 441953 6100029 ~ 6109372 (-)
LOC113536414 c10h2orf73 coding downstream 456547 6085672 ~ 6094778 (-)
sptbn1 sptbn1,LOC108270927,LOC108442064 coding downstream 466518 6001691 ~ 6084807 (-)
ctr9 ctr9 coding upstream 4137 6555719 ~ 6567757 (-)
ampd3a ampd3,ampd3a,LOC108433033 coding upstream 70322 6621904 ~ 6643123 (-)
adma adm coding upstream 97166 6648748 ~ 6651135 (-)
swap70a LOC108271193 coding upstream 242957 6794539 ~ 6807030 (-)
LOC113536768 LOC108270562 coding upstream 258241 6809823 ~ 6816713 (-)
G176992 eif4g2,LOC108433007 non-coding downstream 63 6550914 ~ 6551262 (-)
G176990 NA non-coding downstream 6255 6543999 ~ 6545070 (-)
G176959 NA non-coding downstream 91694 6458366 ~ 6459631 (-)
G176938 NA non-coding downstream 193238 6357574 ~ 6358087 (-)
G176855 NA non-coding downstream 290085 6260797 ~ 6261240 (-)
LOC117598400 NA non-coding upstream 27422 6579004 ~ 6589296 (-)
G177097 NA non-coding upstream 186739 6738321 ~ 6738608 (-)
G177374 notum non-coding upstream 506950 7058532 ~ 7059550 (-)
G177404 NA non-coding upstream 586047 7137629 ~ 7138904 (-)
LOC117598441 NA non-coding upstream 604646 7156228 ~ 7157621 (-)
LOC113536561 srsf7,LOC107665899,LOC107693014 other downstream 843021 5696380 ~ 5708304 (-)
trip4 trip4 other downstream 1354507 5139610 ~ 5196818 (-)
G176307 NA other downstream 1470430 5079817 ~ 5080895 (-)
lto1 oraov1 other downstream 2046996 4498946 ~ 4504329 (-)
bola3 bola3,LOC107686851,LOC107727091 other downstream 2554872 3992726 ~ 3996453 (-)
LOC113536608 LOC108270551 other upstream 305173 6856755 ~ 6861348 (-)
si:dkey-56d12.4 LOC108270721 other upstream 928840 7480422 ~ 7484117 (-)
si:ch1073-365p7.2 NA other upstream 1028852 7580434 ~ 7588815 (-)
igf1rb LOC108271091 other upstream 1124334 7675916 ~ 7764430 (-)
trnar-ucg_7 NA other upstream 1693067 8244649 ~ 8244721 (-)

Expression


Co-expression Network