G31567


Basic Information

Item Value
gene id G31567
gene name NA
gene type non-coding
species striped catfish (Pangasianodon hypophthalmus)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_047596.1
NCBI id CM018542.1
chromosome length 35203048
location 21830726 ~ 21830939 (+)
genome version GENO_Phyp_1.0_2019_striped_catfish_Genome

Sequence

>TU37227
ATTTTTCACCAGTTTTTACCTAACACGGCTTAGGAGCCAATTATCGTAATGAGGTTTGCTTTCCAGAGCTCATTGGTTGTTGTGTCAAATCGCTGATTGGCTCATAGAGCGCCCACGTGTGGTAACATCCGGGACCTCGCTATGTTCAAGCCACTAATAGGATCTTCAGGGATGTAGTGGGTCGCCAACAAGGCTAATAACAACCCAAAAAAAT

Function

NR:

description
PREDICTED: nuclear factor of activated T-cells, cytoplasmic 3 isoform X1

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU37227 True 214 lncRNA 0.45 1 21830726 21830939

Neighbor

gene id symbol gene type direction distance location
si:dkey-148h10.5 NA coding upstream 35217 21783792 ~ 21795509 (+)
jak1 jak1,LOC107739023,LOC107556544,LOC107659055 coding upstream 382643 21408754 ~ 21448083 (+)
wdr78 wdr78 coding upstream 818996 20999483 ~ 21011730 (+)
ttc22 ttc22 coding upstream 841859 20982532 ~ 20988867 (+)
wwc3 wwc3 coding upstream 882089 20894023 ~ 20948637 (+)
dock7 dock7 coding downstream 139035 21969974 ~ 22034090 (+)
kank4 kank4 coding downstream 217577 22048516 ~ 22101105 (+)
LOC117599931 LOC108271599 coding downstream 279009 22109948 ~ 22119632 (+)
cyldl LOC108271977 coding downstream 561889 22392828 ~ 22406479 (+)
ghrhrb ghrhrb,LOC108271568,LOC103030126,LOC108440237,LOC106560417,LOC107692395,LOC107556991,LOC107731650,LOC107704523 coding downstream 595981 22426920 ~ 22474562 (+)
G31565 NA non-coding upstream 3991 21826498 ~ 21826735 (+)
LOC117599889 NA non-coding upstream 188376 21636184 ~ 21642350 (+)
G31384 NA non-coding upstream 217848 21609233 ~ 21612878 (+)
LOC113526220 NA non-coding upstream 424340 21402242 ~ 21406386 (+)
G31260 NA non-coding upstream 445384 21385006 ~ 21385342 (+)
G31693 NA non-coding downstream 317259 22148198 ~ 22148470 (+)
LOC117599240 NA non-coding downstream 333997 22164936 ~ 22165852 (+)
G31704 NA non-coding downstream 351265 22182204 ~ 22188503 (+)
LOC117599245 NA non-coding downstream 389443 22220382 ~ 22221526 (+)
LOC117599246 NA non-coding downstream 396276 22227215 ~ 22231015 (+)
insl5a insl5 other upstream 812859 21014838 ~ 21017867 (+)
dlg1 dlg1,LOC108271975,LOC108427717,LOC107738730 other upstream 1172646 20536973 ~ 20658080 (+)
LOC113543059 c11h1orf146 other upstream 1810500 20000046 ~ 20020226 (+)
smx5 lsm2,LSM2,smx5 other upstream 2293529 19534345 ~ 19537197 (+)
LOC113533886 espnl other upstream 2743515 19061097 ~ 19087211 (+)
tmem69 tmem69 other downstream 766656 22597595 ~ 22603436 (+)
uhmk1 uhmk1,LOC107692420 other downstream 1802667 23633606 ~ 23653555 (+)
G32684 NA other downstream 2189439 24020378 ~ 24021036 (+)
LOC117598985 NA other downstream 2822051 24652990 ~ 24656248 (+)
trak2 LOC108271640 other downstream 3925875 25756814 ~ 25784890 (+)

Expression


Co-expression Network