G219836



Basic Information


Item Value
gene id G219836
gene name NA
gene type non-coding
species striped catfish (Pangasianodon hypophthalmus)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_047608.1
NCBI id CM018554.1
chromosome length 25848897
location 3588212 ~ 3588516 (-)
genome version GENO_Phyp_1.0_2019_striped_catfish_Genome

Sequence


>TU260371
CTAGGCATGACAAGAACTTGATGGGATAAGAACTAGGCAGGAAAAGAACTTAACAGGACATGAAGTAGGTATGACAGGAACTTGGCATGACAAGAACTTGATGGGATAAGAACTTGTCCTGTCAGGTTCTTGTCATGTCATGAGCTAGGTATGACAGGAACTCGGCATGACAAGTACTTGATGGGATAAGAACTAGGCAGGAAAAGAAC

Function


GO: NA

KEGG:

id description
ko04974 Protein digestion and absorption

RNA


RNA id representative length rna type GC content exon number start site end site
TU260371 True 209 lncRNA 0.43 2 3588212 3588516

Neighbor


gene id symbol gene type direction distance location
LOC113544469 NA coding downstream 634228 2946753 ~ 2953984 (-)
sidt2 sidt2 coding downstream 706919 2863388 ~ 2881293 (-)
paf1 paf1,LOC102790690 coding downstream 756199 2824607 ~ 2832013 (-)
LOC113544523 samd4b coding downstream 776032 2799782 ~ 2812180 (-)
LOC113544504 NA coding downstream 793694 2787772 ~ 2794518 (-)
lrfn1 lrfn1,LOC108277437,LOC108440319,LOC107733400 coding upstream 332272 3920788 ~ 4072868 (-)
LOC117599095 NA coding upstream 670647 4259163 ~ 4269047 (-)
LOC113544495 LOC108277689 coding upstream 729475 4317991 ~ 4336898 (-)
LOC113544498 clcn2,LOC108411335,LOC103359445 coding upstream 804260 4392776 ~ 4460707 (-)
chrd chrd coding upstream 892031 4480547 ~ 4491680 (-)
LOC117599091 NA non-coding downstream 67725 3348363 ~ 3520487 (-)
G219697 NA non-coding downstream 557211 3015916 ~ 3031001 (-)
G219678 NA non-coding downstream 596553 2970093 ~ 2991659 (-)
G219632 NA non-coding downstream 652143 2912680 ~ 2936069 (-)
LOC113544648 NA non-coding downstream 748970 2832700 ~ 2839242 (-)
LOC113544520 NA non-coding upstream 232709 3821225 ~ 3825741 (-)
G220278 NA non-coding upstream 692488 4281004 ~ 4325145 (-)
G220290 eif4g1 non-coding upstream 715843 4304359 ~ 4305446 (-)
G220266 NA non-coding upstream 726350 4314866 ~ 4317621 (-)
G220267 NA non-coding upstream 800756 4389272 ~ 4392236 (-)
G219642 NA other downstream 624862 2887907 ~ 2963350 (-)
G219651 NA other downstream 677047 2907326 ~ 2911165 (-)
gal3st2 LOC108261785,LOC108277996 other downstream 958311 2612857 ~ 2629901 (-)
scaf4b LOC108411133 other downstream 1267297 2281401 ~ 2320915 (-)
trnag-ucc_18 NA other downstream 2090801 1497340 ~ 1497411 (-)
igsf11 igsf11 other upstream 138861 3727377 ~ 3807114 (-)
LOC113544484 NA other upstream 151766 3740282 ~ 3816835 (-)
LOC113544632 arap1 other upstream 1309434 4897950 ~ 4971519 (-)
nectin3a LOC108278241 other upstream 1961903 5550419 ~ 5599375 (-)
G220990 NA other upstream 2121582 5710098 ~ 5710891 (-)

Expression



Co-expression Network