G221902 (ada,LOC108277936,LOC100696748,LOC107597532)


Basic Information

Item Value
gene id G221902
gene name ada,LOC108277936,LOC100696748,LOC107597532
gene type non-coding
species striped catfish (Pangasianodon hypophthalmus)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_047608.1
NCBI id CM018554.1
chromosome length 25848897
location 7371370 ~ 7372320 (-)
genome version GENO_Phyp_1.0_2019_striped_catfish_Genome

Sequence

>TU262771
ATAGGTAGTCAGAACTTCAAGTTGTTTATTGTGAAGTTAATGACAGTGAGACACATATGGAACATGTGTATAAACGTGCTTCTCAGTGAACAAACTGACAGGAGCTTGTAACAAACTTAGCTTGTAAGCCTTTAAAGAAAATCAGCACCTTAATATAAATGGTGTTACAGCTGTGTTTAGAAACATGCCACCAAAGAAAAACCTGACTGCATCACGAGTAGAAATTAGAAGAAAATGTTGAACAGTTTAGTCAACTTCTTCAATAGTTGGTCCAGAAGATCCTCCTCCAGGTGCAGCACCACTCCCTGGGAATCCACCGGGCATCCCACCTGGCATGCCACCCGCACCCTGGTACAGCTTGGTGATGATGGGGTTGCACACCTTCTCCAGCTCCTTCTGCTGATGCTCAAACTCATCCTTCTCAGCAGTGGTTCTTGTCCAGCCAGCTGATAACCTCATTGCACTTATCCAGGATCTTCTGCTTGTCCTCATCACTGATCTTTCCTTTCAGTTTCTCATCCTCAACAGTAGACTTCATGTTGAAAGCGTAAGACTCAAGCCCATTCTTTGCAGCTACTTTATCTCGCTGGACATCATCCTCAGCTTTGTATTTCTCTGCTTCCTGGACCATTCGCTCAATGTCCTCCTTGCTGAGACG

Function

symbol description
ada Enables adenosine deaminase activity. Predicted to be involved in T cell activation; negative regulation of adenosine receptor signaling pathway; and nucleobase-containing small molecule metabolic process. Predicted to act upstream of or within nucleotide metabolic process and purine ribonucleoside monophosphate biosynthetic process. Predicted to be located in several cellular components, including cell junction; cytoplasmic vesicle lumen; and lysosome. Predicted to be active in cytosol and external side of plasma membrane. Is expressed in several structures, including digestive system; gill; heart; kidney; and muscle. Human ortholog(s) of this gene implicated in adenosine deaminase deficiency; asthma; and severe combined immunodeficiency. Orthologous to human ADA (adenosine deaminase).

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU262771 True 658 lncRNA 0.45 2 7371370 7372320

Neighbor

gene id symbol gene type direction distance location
LOC113532840 LOC108277937 coding downstream 6227 7355180 ~ 7365143 (-)
LOC113532980 LOC108277641,LOC108435272,LOC106613048,LOC106581142,LOC105005794 coding downstream 87397 7276448 ~ 7283973 (-)
alcamb LOC108278292 coding downstream 117764 7229918 ~ 7253606 (-)
dyrk1ab dyrk1a,LOC108278223,LOC108435291,LOC107726100,LOC107662773 coding downstream 145824 7198831 ~ 7225546 (-)
trnap-cgg_8 NA coding downstream 175776 7195523 ~ 7195594 (-)
lim2.3 lim2.3,LOC108277938,LOC108435296,LOC103047043,LOC107748598,LOC107699889,LOC107597599 coding upstream 94 7372414 ~ 7376065 (-)
acad8 acad8,LOC107582571 coding upstream 177507 7549827 ~ 7563594 (-)
vps26b vps26b,LOC103021802,LOC107582573,LOC107699898,LOC107748589 coding upstream 198881 7571201 ~ 7576277 (-)
jam3a jam3 coding upstream 205735 7578055 ~ 7591818 (-)
cadm1b cadm1b,LOC108277410,LOC108435304,LOC107713448,LOC107662762,LOC107582575 coding upstream 372979 7745299 ~ 7907858 (-)
G221844 NA non-coding downstream 150441 7218666 ~ 7220929 (-)
G221814 NA non-coding downstream 193074 7133517 ~ 7178296 (-)
G221812 NA non-coding downstream 247168 7122717 ~ 7124202 (-)
G221683 colca2 non-coding downstream 498011 6872831 ~ 6873359 (-)
G221682 colca2 non-coding downstream 499391 6871737 ~ 6871979 (-)
LOC113532601 NA non-coding upstream 204234 7576554 ~ 7577056 (-)
G222367 NA non-coding upstream 760043 8132363 ~ 8132704 (-)
G222377 NA non-coding upstream 790313 8162633 ~ 8162848 (-)
G222391 NA non-coding upstream 824485 8196805 ~ 8197207 (-)
G222522 NA non-coding upstream 868744 8241064 ~ 8242176 (-)
LOC113532805 NA other downstream 717952 6619172 ~ 6653418 (-)
dynll2a dynll2a,LOC107554284 other downstream 1347017 6021145 ~ 6024353 (-)
LOC113532612 LOC108277970 other downstream 1567397 5797928 ~ 5803973 (-)
G220990 NA other downstream 1660479 5710098 ~ 5710891 (-)
nectin3a LOC108278241 other downstream 1771995 5550419 ~ 5599375 (-)
zgc:77784 LOC108277423 other upstream 20095 7392415 ~ 7463499 (-)
sorl1 sorl1,LOC107717255 other upstream 1032509 8404829 ~ 8478912 (-)
G222809 oaf other upstream 1568698 8941018 ~ 8946899 (-)
LOC113532707 LOC108277821,LOC108277480,LOC108277820,LOC108277479,LOC108277478 other upstream 2304939 9677259 ~ 9713059 (-)
LOC113533081 LOC108277503,LOC108425821,LOC103022652 other upstream 2935730 10308050 ~ 10312516 (-)

Expression


Co-expression Network