G223443 (aldh3a2a,aldh3a1,LOC108277490,LOC107657568,LOC105897199)


Basic Information

Item Value
gene id G223443
gene name aldh3a2a,aldh3a1,LOC108277490,LOC107657568,LOC105897199
gene type non-coding
species striped catfish (Pangasianodon hypophthalmus)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_047608.1
NCBI id CM018554.1
chromosome length 25848897
location 10089643 ~ 10089990 (-)
genome version GENO_Phyp_1.0_2019_striped_catfish_Genome

Sequence

>TU264558
CATACTGTAACATAATTTAAGGTAATAATGAAAGCAAGTTGGTGCATTCAAATCAAATGAGCTTGTAAACAATGTGTTACCGGCAAGCAACTGCAAGATCACAGTTCTGATCAATATAACAGGGACTTTTCCCCCCCAGCTCCAGAGTGACTGGTGTGAGGTGGTGTGCAGCTGCTTCCATAACCAGTTTCCCCACTGTGCTGTTTCCTGTGTAGAAGATGTGATCGAAACGCTGCTTGAGCAACTCCTGGGTTTCAGGAACTCCTCCAGTCACCACATGGTACATCTCCTTAAAGATTCAAACAAACATTATATTACACAACAGTCATGCTTATGTAGGTTCATAAC

Function

symbol description
aldh3a2a Predicted to enable 3-chloroallyl aldehyde dehydrogenase activity. Predicted to act upstream of or within cellular aldehyde metabolic process. Predicted to be located in membrane. Predicted to be integral component of membrane. Human ortholog(s) of this gene implicated in Sjogren-Larsson syndrome and arteriosclerosis. Orthologous to human ALDH3A1 (aldehyde dehydrogenase 3 family member A1) and ALDH3A2 (aldehyde dehydrogenase 3 family member A2).
aldh3a1 Predicted to enable 3-chloroallyl aldehyde dehydrogenase activity. Predicted to act upstream of or within cellular aldehyde metabolic process. Predicted to be located in membrane. Predicted to be integral component of membrane. Human ortholog(s) of this gene implicated in arteriosclerosis. Orthologous to human ALDH3A1 (aldehyde dehydrogenase 3 family member A1).

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU264558 True 348 lncRNA 0.43 1 10089643 10089990

Neighbor

gene id symbol gene type direction distance location
ulk2 ulk2,LOC107717276,LOC107657566 coding downstream 18916 10040742 ~ 10070727 (-)
LOC113532742 LOC108277821,LOC108277480,LOC108277478,LOC108277820,LOC108277479 coding downstream 223312 9839316 ~ 9866331 (-)
LOC113532826 LOC108277820 coding downstream 254556 9823069 ~ 9835087 (-)
LOC117599039 LOC108277821,LOC108277820,LOC108277479,LOC108277480,LOC108277478,LOC108411099,LOC108411100,LOC108411104,LOC108411102,LOC108411101 coding downstream 266956 9717745 ~ 9822687 (-)
nlrx1 nlrx1 coding downstream 415197 9664911 ~ 9674446 (-)
sgsm2 sgsm2,LOC108277483,LOC107728220 coding upstream 73417 10163407 ~ 10208971 (-)
tnfaip1 tnfaip1,LOC108277497,LOC108425816,LOC107728221,LOC107597551,LOC107657549,LOC107586309,LOC107729096,LOC107662792 coding upstream 121596 10211586 ~ 10218371 (-)
supt5h supt5h,LOC107657557,LOC107586261 coding upstream 230841 10320831 ~ 10342885 (-)
il15l NA coding upstream 255600 10345590 ~ 10356732 (-)
plekhg2 plekhg2,LOC106612677 coding upstream 267559 10357549 ~ 10400261 (-)
G223437 LOC108277491,LOC108425811,LOC107662794,LOC107729125,LOC107586255 non-coding downstream 7526 10081581 ~ 10082117 (-)
G223410 NA non-coding downstream 50285 10038844 ~ 10039358 (-)
G223408 NA non-coding downstream 53661 10035742 ~ 10035982 (-)
G223353 NA non-coding downstream 111083 9931356 ~ 9978560 (-)
LOC117599021 NA non-coding downstream 193882 9887016 ~ 9895761 (-)
G223449 NA non-coding upstream 10969 10100959 ~ 10101166 (-)
G223676 NA non-coding upstream 71793 10161783 ~ 10163372 (-)
G223766 NA non-coding upstream 322466 10412456 ~ 10412680 (-)
G223808 NA non-coding upstream 470436 10560426 ~ 10611848 (-)
G223827 NA non-coding upstream 546166 10636156 ~ 10636794 (-)
LOC113532707 LOC108277821,LOC108277480,LOC108277820,LOC108277479,LOC108277478 other downstream 376584 9677259 ~ 9713059 (-)
G222809 oaf other downstream 1142744 8941018 ~ 8946899 (-)
sorl1 sorl1,LOC107717255 other downstream 1610731 8404829 ~ 8478912 (-)
zgc:77784 LOC108277423 other downstream 2626144 7392415 ~ 7463499 (-)
LOC113532805 NA other downstream 3436225 6619172 ~ 6653418 (-)
LOC113533081 LOC108277503,LOC108425821,LOC103022652 other upstream 218060 10308050 ~ 10312516 (-)
appbp2 appbp2 other upstream 618262 10708252 ~ 10721333 (-)
aipl1 aipl1,LOC106612843 other upstream 1098260 11188250 ~ 11220656 (-)
tbx4 tbx4,LOC107548556,LOC107685071,LOC107664909,LOC107589698,LOC107743740,LOC107757041 other upstream 2298876 12388866 ~ 12407489 (-)
bcas3 bcas3,LOC107743646 other upstream 2345216 12435206 ~ 12638725 (-)

Expression


Co-expression Network