G252859 (lrrc23)


Basic Information

Item Value
gene id G252859
gene name lrrc23
gene type non-coding
species striped catfish (Pangasianodon hypophthalmus)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_047610.1
NCBI id CM018556.1
chromosome length 25111544
location 10782135 ~ 10782588 (-)
genome version GENO_Phyp_1.0_2019_striped_catfish_Genome

Sequence

>TU299332
CTGACCTATAAGATTAAGGTTTTCCAGTGCAGGCCCACCAAGGCCCTCTGTGTCACTCAAACGATTGGACCTGAGGCTGAGCCACTGCAGATAAGGAAGCTGGCTGAGTGGCTGACCTCGAACACTCTGAACCTGATTGGCATCTGCCTTTAGCCAAAGCAGCTCGGTCAGAGTAGCCAGTGGAGAAAGGTCTGTCAGGTAGTTGGAGGAGATGTCCAGGAAACGCAGATAGACAAATGAACTCAACATGACAATATCCGCCAGATTCCTGAATAAGCAGTGATGAAGACAATAGTGTAATTGTTTATCTCTAAAACACAAGTACAACAACCCAAAAAAGTACTACTGAACAAGGAAATCCTTGTGCTATGCACATTCACTTCAGTTTTGCTTACACTTTATAAAAATACCTGTTTTGTAGGTCAAGTCTGACAAATGCATGCGAAAGTCCATC

Function

symbol description
lrrc23 Acts upstream of or within cilium movement involved in otolith formation. Predicted to be active in cytosol. Is expressed in several structures, including Kupffer's vesicle; forerunner cell group; nervous system; pronephric duct; and spinal cord neural keel. Orthologous to human LRRC23 (leucine rich repeat containing 23).

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU299332 True 454 lncRNA 0.44 1 10782135 10782588

Neighbor

gene id symbol gene type direction distance location
LOC113530767 si:rp71-17i16.4,tnnc2,LOC103044939,LOC108275548,LOC108434838,LOC107737591,LOC107568845,LOC108233014,LOC103151310 coding downstream 151874 10625640 ~ 10630261 (-)
tnnc2 LOC108434847,LOC108276484,LOC103044421 coding downstream 158342 10620673 ~ 10623793 (-)
LOC113530527 col20a1,slc35c2,LOC108275935,LOC107699598,LOC107593422,LOC107565826,LOC107712705,LOC107699599,LOC107737589 coding downstream 162470 10570109 ~ 10619665 (-)
dpm1 dpm1,LOC107712706,LOC107737709,LOC107671953,LOC106566454 coding downstream 213376 10562324 ~ 10568759 (-)
adnpb LOC108275936 coding downstream 220664 10548390 ~ 10561471 (-)
tnnc1b tnnc1b,LOC107671989,LOC107568847,LOC108276054,LOC107593406,LOC105890642,LOC103374679 coding upstream 13219 10795807 ~ 10798598 (-)
cfap126 LOC108276287,LOC108276289 coding upstream 70429 10853017 ~ 10856962 (-)
emd LOC108275784 coding upstream 149518 10932106 ~ 10941252 (-)
flna flna,LOC101154674,LOC108436314,LOC107712729 coding upstream 160287 10942875 ~ 10973775 (-)
dnase1l1 LOC108275786 coding upstream 216512 10999100 ~ 11004596 (-)
G252856 NA non-coding downstream 2535 10778985 ~ 10779600 (-)
G252833 NA non-coding downstream 70644 10710395 ~ 10711491 (-)
G252783 NA non-coding downstream 126613 10655314 ~ 10655522 (-)
G252610 NA non-coding downstream 385395 10396395 ~ 10396740 (-)
LOC117599279 NA non-coding downstream 493451 10244041 ~ 10288684 (-)
G252920 NA non-coding upstream 82772 10865360 ~ 10865700 (-)
G252921 NA non-coding upstream 83648 10866236 ~ 10866696 (-)
G252944 LOC107560942,LOC107672007,LOC107737604 non-coding upstream 122298 10904886 ~ 10912465 (-)
G252967 NA non-coding upstream 212228 10994816 ~ 10997436 (-)
G252969 NA non-coding upstream 223364 11005952 ~ 11006617 (-)
sinup NA other downstream 143417 10636501 ~ 10638718 (-)
usp21 LOC108276040,LOC108432659 other downstream 312339 10460694 ~ 10469796 (-)
G252373 NA other downstream 752142 10029492 ~ 10029993 (-)
LOC117599234 LOC108275963 other downstream 1010572 9768247 ~ 9771563 (-)
ttll10 ttll10 other downstream 2203535 8566656 ~ 8578600 (-)
LOC113530950 smim4,zgc:193598,LOC108436318,LOC108276132,LOC107570281 other upstream 226875 11009463 ~ 11015666 (-)
abhd6b LOC108275644,LOC108436291 other upstream 237943 11020531 ~ 11025009 (-)
LOC113530309 NA other upstream 673432 11456020 ~ 11462706 (-)
avpr2ab avpr2,avpr2ab,LOC108275514,LOC106567019,LOC106572707,LOC108436342,LOC107672000 other upstream 766806 11549394 ~ 11568603 (-)
LOC113530816 LOC108276066,LOC108276064,LOC108276065,LOC108275619 other upstream 1056208 11838796 ~ 11859346 (-)

Expression


Co-expression Network