G253538


Basic Information

Item Value
gene id G253538
gene name NA
gene type non-coding
species striped catfish (Pangasianodon hypophthalmus)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_047610.1
NCBI id CM018556.1
chromosome length 25111544
location 11904277 ~ 11904686 (-)
genome version GENO_Phyp_1.0_2019_striped_catfish_Genome

Sequence

>TU300190
GGCAGTGAGAAGTTTAATTTTAGTGCAATCTGAAGGTCCACCTGTAAAATATCTTGCTCATTGAGCTCGATGAGCAGTTTGAGGTTATGTTCGAGTTCAGGCAGAGCAAAACACGAGCTCTTCTGCTCTCGTGCACTTGCACTCATAGGAGCCTCCTCAGGAATGCTGTGCTTTTGGCTCATCTGACTGTAGCTGTAGTAGACCTTCTGCTCCCGGCCTGTCATATCTAACCTTGACTTGGGCAAGTTCTCCAGCTGGTTGGCTCA

Function

GO: NA

KEGG:

id description
ko04974 Protein digestion and absorption

RNA

RNA id representative length rna type GC content exon number start site end site
TU300190 True 266 lncRNA 0.48 2 11904277 11904686

Neighbor

gene id symbol gene type direction distance location
naca naca,LOC106571941 coding downstream 3815 11892151 ~ 11900462 (-)
LOC113530993 NA coding downstream 11275 11892927 ~ 11893002 (-)
LOC113530992 NA coding downstream 11857 11892348 ~ 11892420 (-)
LOC113530663 LOC108275530,LOC108435244,LOC107560901,LOC107671993 coding downstream 12251 11884544 ~ 11892026 (-)
nfascb LOC108276480,LOC108435243,LOC107737654,LOC107672057,LOC107741310 coding downstream 20254 11863151 ~ 11884023 (-)
prim1 prim1,LOC107741309 coding upstream 3240 11907926 ~ 11915984 (-)
rnd1a rnd1a,LOC108275558,LOC103027302,LOC108435239,LOC105906806,LOC107657046,LOC107737660,LOC107563659 coding upstream 22220 11926906 ~ 11932495 (-)
slc17a9b slc17a9,slc17a9b,LOC107563661,LOC107560897,LOC106566596 coding upstream 163903 12068589 ~ 12083533 (-)
gid8b gid8b,gid8,LOC108276161,LOC107560896,LOC108231957,LOC107391203,LOC105906441 coding upstream 179299 12083985 ~ 12087721 (-)
trnae-cuc_33 NA coding upstream 236416 12141102 ~ 12141173 (-)
G253509 NA non-coding downstream 126344 11777718 ~ 11777933 (-)
G253492 NA non-coding downstream 146347 11755205 ~ 11757930 (-)
G253499 NA non-coding downstream 160119 11743950 ~ 11744158 (-)
G253494 NA non-coding downstream 189524 11712997 ~ 11714753 (-)
G253433 NA non-coding downstream 283882 11613240 ~ 11620395 (-)
LOC113530483 NA non-coding upstream 238947 12143633 ~ 12150945 (-)
G253749 NA non-coding upstream 312738 12217424 ~ 12217744 (-)
G253843 NA non-coding upstream 487677 12392363 ~ 12393653 (-)
LOC113530910 NA non-coding upstream 701855 12606541 ~ 12607682 (-)
G253977 NA non-coding upstream 756558 12661244 ~ 12709317 (-)
LOC113530816 LOC108276066,LOC108276064,LOC108276065,LOC108275619 other downstream 44931 11838796 ~ 11859346 (-)
avpr2ab avpr2,avpr2ab,LOC108275514,LOC106567019,LOC106572707,LOC108436342,LOC107672000 other downstream 335674 11549394 ~ 11568603 (-)
LOC113530309 NA other downstream 441571 11456020 ~ 11462706 (-)
abhd6b LOC108275644,LOC108436291 other downstream 879268 11020531 ~ 11025009 (-)
LOC113530950 smim4,zgc:193598,LOC108436318,LOC108276132,LOC107570281 other downstream 888611 11009463 ~ 11015666 (-)
ptk6b LOC108276246 other upstream 251042 12155728 ~ 12167795 (-)
plagl2 plagl2,LOC107690855,LOC107681868,LOC107559482,LOC107747490,LOC107558237,LOC107707758 other upstream 992788 12897474 ~ 12934308 (-)
oprl1 oprl1,LOC107681404,LOC107727003,LOC107666560 other upstream 1346454 13251140 ~ 13283885 (-)
LOC113530423 LOC108276099 other upstream 2224277 14128963 ~ 14150581 (-)
G255071 krt8,LOC108411779,LOC100304655,LOC107551542,LOC107681390,LOC107705700,LOC107666368,LOC102212080,LOC102292851,LOC102776167,LOC101486263,LOC103367855,LOC107391340 other upstream 2794586 14699272 ~ 14704270 (-)

Expression


Co-expression Network