G256899 (bcas1)


Basic Information

Item Value
gene id G256899
gene name bcas1
gene type non-coding
species striped catfish (Pangasianodon hypophthalmus)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_047610.1
NCBI id CM018556.1
chromosome length 25111544
location 18322069 ~ 18328256 (+)
genome version GENO_Phyp_1.0_2019_striped_catfish_Genome

Sequence

>TU304013
AGACTTCTGGCTCTCGGTCTCTACTGCAGGGACGATCTGTACTTCAGCTGCCACATTAGCCTCAGATGCAGGTAAAACAAGCATGGTCTTCTTCTTGAACATCTTACTGAACACGGTGGGAGTCTCAGCTTGTTTAGGTGTGTCTTTGGCTGGTGTACTGGACTCTGCTGGAACTTTTTGTTCAGCTGATACAGTTGTAGCACTGACTTGGATACCATCTGCTTCCACAGACACAGCTGGAGCTTTTGCTTGGGTGCCATTAACTTCTACTGACGCTGGTGCTGGCTTCTGTAATATTGAGGA
>TU304014
AGACTTTTGGCTCTCGGTCTCTACTGCAGGGACGATCTGTACTTCAGCTGCCACATTAGCCTCAGATGCAGGTAAAACAAGCCCAGTCTTCTTCTTGAACATCTTACTGAACACGGTGGGAGTCTCAGCTTGTTTAGGTGTGTCTTTGGCTGGTGTACTGGACTCTGCTGGAACTTTTTGTTCAGCTGATACAGTTGTAGCACTGACTTGGATACCATCTGCTTCCACAGACACAGCTGGAGCTTTTGCTTGGGTGCCATTAGCTTCTACTGACGCTGGTGCTGGCTTCTGTAATATTCAGGAaacttaatttgtttttgttaattgattttgcctttatacaccaccacaatggatttgaaataaaacaatcaaggtGTG

Function

symbol description
bcas1 Predicted to be involved in myelination. Located in extracellular exosome.

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU304013 False 303 lncRNA 0.48 2 18322069 18324070
TU304014 True 381 lncRNA 0.44 2 18326232 18328256

Neighbor

gene id symbol gene type direction distance location
LOC113530861 tshz2,LOC107758790,LOC107664189,LOC107729067,LOC107697876 coding upstream 81157 18193197 ~ 18240912 (+)
si:ch211-66i15.4 NA coding upstream 575540 17739271 ~ 17746529 (+)
si:dkey-261h17.1 NA coding upstream 645765 17649314 ~ 17676304 (+)
plxna2 plxna2,LOC108425528,LOC107594012 coding upstream 695011 17427302 ~ 17627058 (+)
hrct1 LOC108276455 coding upstream 1127823 17189879 ~ 17194246 (+)
pfdn4 pfdn4,LOC107697845,LOC107758785,LOC106572636 coding downstream 18519 18346775 ~ 18351473 (+)
cd40 NA coding downstream 162225 18490481 ~ 18497402 (+)
casp9 casp9 coding downstream 282897 18611153 ~ 18620055 (+)
arhgap4a LOC108276165 coding downstream 295215 18623471 ~ 18644765 (+)
LOC113530736 ssr4,ssrd,LOC108275523,LOC108425558,LOC106567025 coding downstream 318452 18646708 ~ 18651829 (+)
G256851 zfp64 non-coding upstream 241737 18078167 ~ 18080332 (+)
G256852 NA non-coding upstream 244257 18076948 ~ 18077812 (+)
G256772 NA non-coding upstream 376970 17944895 ~ 17945099 (+)
G256771 NA non-coding upstream 378714 17943151 ~ 17943355 (+)
G256726 NA non-coding upstream 443583 17877613 ~ 17878486 (+)
G257068 NA non-coding downstream 291993 18620249 ~ 18621305 (+)
LOC113530356 NA non-coding downstream 513497 18841753 ~ 18846347 (+)
G257127 NA non-coding downstream 563633 18891889 ~ 18936842 (+)
G257196 NA non-coding downstream 737598 19065854 ~ 19066133 (+)
G257199 NA non-coding downstream 789621 19117877 ~ 19118533 (+)
LOC113530386 slc26a9 other upstream 1133692 17175701 ~ 17188377 (+)
itga5 itga5,LOC107599342,LOC107723722 other upstream 1197118 17071136 ~ 17124951 (+)
G256046 NA other upstream 1813689 16508025 ~ 16508380 (+)
LOC113530371 LOC108276302,LOC108443130,LOC107673205 other upstream 1925824 16363546 ~ 16396245 (+)
spo11 spo11 other upstream 1995455 16232013 ~ 16326614 (+)
fmnl3 LOC108276057,LOC108425567,LOC107716159 other downstream 551225 18879481 ~ 18934319 (+)
pkig NA other downstream 870170 19198426 ~ 19222559 (+)
G257622 LOC108276210 other downstream 1150046 19478302 ~ 19478895 (+)
si:ch73-206d17.1 LOC108275771 other downstream 1297273 19625529 ~ 19705063 (+)
G258096 hoxc6,hoxc6a,LOC107593966,LOC108433405,LOC107664205,LOC107714999,LOC103034651 other downstream 2062553 20390809 ~ 20398714 (+)

Expression


Co-expression Network