G266871 (frem2a,LOC108276566,LOC107701139,LOC107555183,LOC107693873,LOC107718779,LOC107720635)



Basic Information


Item Value
gene id G266871
gene name frem2a,LOC108276566,LOC107701139,LOC107555183,LOC107693873,LOC107718779,LOC107720635
gene type non-coding
species striped catfish (Pangasianodon hypophthalmus)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_047611.1
NCBI id CM018557.1
chromosome length 24879021
location 10580859 ~ 10581182 (+)
genome version GENO_Phyp_1.0_2019_striped_catfish_Genome

Sequence


>TU316252
CCGTCAGTCCCGATGCTCCCGCCGCAGTCTGTGAGCAGCTCAGACATGTCATAATAACTCACAAACTCCCACAGACAGGCCTCCAGATTGAGGTTCCTGTAGAAGTGTAGCGTGTTCAGGCCCCTCATGGTAGAGTTATATTGGTAGGGAGCGCTCTCTCCAATTTGTTCTGCACTCTTCGTGGCCTTCGTCAGGAAGCCGTGGCGTGTGGGAACCTCATCAAAGTCCAGCAGATTGGAGCAGCGGTGGTTCCCTACACGGCTGCCATCCGGACTCAGGGTCAACTCGAAGTTGGACAGAGCACGAGTAGAGAGCACAGGGAGC

Function


symbol description
frem2a Acts upstream of or within fin morphogenesis. Predicted to be located in membrane. Predicted to be integral component of membrane. Is expressed in fin; fin fold pectoral fin bud; median fin fold; pharyngeal arch; and trunk. Human ortholog(s) of this gene implicated in Fraser syndrome 2 and isolated cryptophthalmia. Orthologous to human FREM2 (FRAS1 related extracellular matrix 2).

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU316252 True 324 lncRNA 0.56 1 10580859 10581182

Neighbor


gene id symbol gene type direction distance location
trim3b trim3b,LOC108276924,LOC108423836,LOC107701140,LOC107557229,LOC107720632,LOC107718737 coding upstream 26608 10520018 ~ 10554251 (+)
fhdc3 LOC108276923 coding upstream 61643 10507226 ~ 10519216 (+)
arfip2b arfip2b,LOC108276920,LOC108438961,LOC107718740,LOC107555180,LOC107701145,LOC107557232 coding upstream 75417 10485024 ~ 10505442 (+)
dchs1b LOC108277286,LOC108438972,LOC107718741,LOC107701146,LOC107555179,LOC105907404,LOC107720538,LOC107693876 coding upstream 132694 10353267 ~ 10448165 (+)
slc46a3 slc46a3 coding upstream 260688 10302573 ~ 10320171 (+)
trpc4a trpc4,LOC108423767 coding downstream 157120 10738302 ~ 10759716 (+)
postna postn coding downstream 195120 10776302 ~ 10811764 (+)
sod1 sod1 coding downstream 303094 10884276 ~ 10890564 (+)
tiam1a tiam1,LOC108423828 coding downstream 333520 10914702 ~ 10975096 (+)
grik1a grik1,grik1a,LOC107555187,LOC107701130,LOC107718733,LOC107693913 coding downstream 396912 10978094 ~ 11035327 (+)
G266869 NA non-coding upstream 8712 10571891 ~ 10572147 (+)
G266802 NA non-coding upstream 33677 10546821 ~ 10547182 (+)
G266580 NA non-coding upstream 577498 10003146 ~ 10003361 (+)
G266499 stard13,LOC107691680 non-coding upstream 635280 9944113 ~ 9945579 (+)
G266497 NA non-coding upstream 640559 9937395 ~ 9940300 (+)
G266892 NA non-coding downstream 85636 10666818 ~ 10668314 (+)
G266901 NA non-coding downstream 151355 10732537 ~ 10734630 (+)
G266946 NA non-coding downstream 238344 10819526 ~ 10819739 (+)
G267051 NA non-coding downstream 454816 11035998 ~ 11036230 (+)
G267062 NA non-coding downstream 461035 11042217 ~ 11042390 (+)
G266868 LOC108276566 other upstream 10154 10569028 ~ 10570705 (+)
dclk1a dclk1,LOC107728871,LOC107577778 other upstream 818162 9704360 ~ 9762697 (+)
LOC113543674 NA other upstream 1156004 9419665 ~ 9424855 (+)
G266161 NA other upstream 1244569 9335801 ~ 9336290 (+)
LOC113534874 LOC108276751 other upstream 1316748 9256943 ~ 9264111 (+)
scaf4a scaf4,LOC107555128 other downstream 284430 10865612 ~ 10882265 (+)
vps36 vps36,LOC107701118 other downstream 4181131 14762313 ~ 14771073 (+)
trnar-ccu_11 NA other downstream 6506486 17087668 ~ 17087740 (+)
trnam-cau_40 NA other downstream 6506566 17087748 ~ 17087819 (+)
trnar-ccu_12 NA other downstream 6507267 17088449 ~ 17088521 (+)

Expression



Co-expression Network