G274321


Basic Information

Item Value
gene id G274321
gene name NA
gene type non-coding
species striped catfish (Pangasianodon hypophthalmus)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_047611.1
NCBI id CM018557.1
chromosome length 24879021
location 23839988 ~ 23840458 (-)
genome version GENO_Phyp_1.0_2019_striped_catfish_Genome

Sequence

>TU325003
CTCAAAGAGCTGTCTCAAAGAGCTGTCTCAAAGAGCTGTCTCAAAGAGCTGAATTAAAGAAAGAGGCGACTCAAAGAACCTACTTAAAAAGCTGACTGAAAGATCTGAATCAGAGTCAATTCAGAGATCACTAAAATAGGTCACTCAAAGTCGGGACTCAAAGAGATGACGTAACGAGTTGACTCAAAGAGCTGACTCAAAGATCTGATTTGAAAAGATGAATCTGTGCCAACTCAAAGAAATCACTAAAAGAGCTGCCTCCAAGGGCTAACTCAAATAGATGAATCAAGGAGCTGAATCA

Function

GO: NA

KEGG:

id description
ko04975 Fat digestion and absorption

RNA

RNA id representative length rna type GC content exon number start site end site
TU325003 True 301 lncRNA 0.40 2 23839988 23840458

Neighbor

gene id symbol gene type direction distance location
dbh dbh coding downstream 94455 23723727 ~ 23745533 (-)
strbp strbp,LOC107744073,LOC107686417 coding downstream 332486 23394533 ~ 23507502 (-)
morn5 morn5 coding downstream 676522 23150003 ~ 23163466 (-)
mrrf mrrf coding downstream 735330 23085312 ~ 23104658 (-)
LOC113544094 anxa3 coding downstream 769940 23061736 ~ 23070048 (-)
exd3 exd3 coding upstream 33235 23873693 ~ 23935370 (-)
ak3 ak3,LOC107658667,LOC107685112,LOC107744244,LOC107713310 coding upstream 103917 23944375 ~ 23956050 (-)
ptbp3 ptbp3,LOC107658670,LOC107744247 coding upstream 200573 24041031 ~ 24095321 (-)
LOC113543977 NA coding upstream 277565 24118023 ~ 24193873 (-)
LOC117599328 LOC107690397,LOC107716059,LOC107572820 coding upstream 324919 24165377 ~ 24171214 (-)
G274355 NA non-coding downstream 10229 23824093 ~ 23829759 (-)
G274339 NA non-coding downstream 49844 23789458 ~ 23790144 (-)
LOC113544044 NA non-coding downstream 59218 23778853 ~ 23780770 (-)
G274290 NA non-coding downstream 92808 23720984 ~ 23747180 (-)
G274294 NA non-coding downstream 173659 23664861 ~ 23666329 (-)
G274361 NA non-coding upstream 7902 23848360 ~ 23848564 (-)
G274370 NA non-coding upstream 27784 23868242 ~ 23868457 (-)
G274383 NA non-coding upstream 98738 23939196 ~ 23942218 (-)
G274380 NA non-coding upstream 102954 23943412 ~ 24020906 (-)
G274386 NA non-coding upstream 141714 23982172 ~ 24015670 (-)
G274342 slc27a4 other downstream 37704 23798359 ~ 23802284 (-)
LOC113544130 rusc2 other downstream 2632818 21189969 ~ 21207170 (-)
drg1 drg1,LOC107744129,LOC107567440,LOC107713382,LOC107555524 other downstream 3058914 20772560 ~ 20781074 (-)
pmaip1 NA other downstream 3725529 20111448 ~ 20114459 (-)
G272551 NA other downstream 3759077 20079415 ~ 20080911 (-)
nrarpa nrarp,nrarpa other upstream 18847 23859305 ~ 23863268 (-)
inip inip,LOC107571239,LOC107658659,LOC107558675 other upstream 411090 24251548 ~ 24253312 (-)
LOC113544170 plac8 other upstream 457018 24297476 ~ 24301032 (-)

Expression


Co-expression Network