G319995 (rnf126,LOC107750906,LOC107569633,LOC107596227,LOC107754583)


Basic Information

Item Value
gene id G319995
gene name rnf126,LOC107750906,LOC107569633,LOC107596227,LOC107754583
gene type non-coding
species striped catfish (Pangasianodon hypophthalmus)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_047615.1
NCBI id CM018561.1
chromosome length 21248730
location 14009909 ~ 14010528 (-)
genome version GENO_Phyp_1.0_2019_striped_catfish_Genome

Sequence

>TU378970
TCTAAAGTGGGCACTCCTTCGTGCCGTGTCCCTTGTCTCCGGGGAATGTGGCGCCCCCGAGGTTGTCTGGCCCCGTAGCGTTGGCGTGATGCCATCTCCCGCTCCCGCCGGTTCTCAGCATCGCGCCCGTCCTCAGAGGGCATGCCCGTCCGGAGATCAAAACCCTCGCCGAAGATGCCCAGAGCCAGCTGGCCGTACGGGTGTGGGAAGGTAAATAGTGTCGGGTCCACATTCTGTGAAAACAGCAAGACGACTGTTAGATGGTTCACTTACTTTTGCT
>TU378973
aaaaattcaaaccaattgacaatcacacacaaagTATTGTAAagcttaaataaaacaaataataagcGTGAATTCTGCATTAACATACCATGGTCCCATTCCCATGTTTGGCATAGCTGTTGGCGCGATGATTCCATTTACTAACTGCTGAATTATTCTGTTGAAACACAAAATCAAATCCTTACACTGTATCTGGGGGGGCGCAATCAAGCGCAGACAGCAATCAAGTCACACTCAAACTGAAATGCCTTGGCACTACATGCCATCTGTCCCGTCACTGCTCTAAAGTTGGCACTGCTTGACAATATCTGTCTGTCCTGTCAAGTCCAGCACTCACCCCTCTAAAGTGGGCACTCCTTCGTGCCGTGTCCCTTGTCTCCGGGGAATGTGGCGCCCCCGAGGTTGTCTGGCCCCGTAGCGTTGGCGTGATGCCATCTCCCGCTCCCGCCGGTTCTCAGCATCGCGCCCGTCCTCAGAGGGCATGCCCGTCCGGAGATCAAAACCCTCGCCGAAGATGCCCAGAGCCAGCTGGCCGTACGGGTGTGGGAAGGTAAATAGTGTCGGGTCCACATTCTGTGAAAACAGCAAGACGACTGTTAGATGGTTCACTTACTTTTGCT

Function

symbol description
rnf126 Predicted to enable metal ion binding activity and ubiquitin protein ligase activity. Orthologous to human RNF126 (ring finger protein 126).

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU378970 False 280 lncRNA 0.60 1 14009909 14010188
TU378973 True 620 lncRNA 0.50 1 14009909 14010528

Neighbor

gene id symbol gene type direction distance location
acss2l LOC108280639,LOC108442433,LOC107750908 coding downstream 78771 13909865 ~ 13931138 (-)
napgb napg,LOC107750913,LOC107696142,LOC105907026,LOC107687900 coding downstream 190448 13807775 ~ 13819461 (-)
LOC113533381 LOC108280169,LOC108439884,LOC100333521,LOC107696163 coding downstream 299212 13705300 ~ 13710697 (-)
abhd8a abhd8a,LOC108280232,LOC108439870,LOC107696148,LOC107754588,LOC107687901,LOC107596234,LOC103352801 coding downstream 306491 13693403 ~ 13703418 (-)
capsla LOC108280735,LOC108439882,LOC107552688 coding downstream 348729 13658694 ~ 13661180 (-)
LOC113533496 celf5,LOC108280171,LOC108444550,LOC107750904,LOC107696073,LOC107667861 coding upstream 131675 14142203 ~ 14336583 (-)
rxfp3.2a LOC108280335,LOC107729970,LOC107558276,LOC107667854,LOC107600262,LOC107696777,LOC107750939 coding upstream 391401 14401929 ~ 14404823 (-)
creb3l3b creb3l3 coding upstream 397924 14408452 ~ 14429093 (-)
plpp2a plpp2,LOC108427214,LOC107558288,LOC107729984,LOC107713693,LOC107667850 coding upstream 660744 14671272 ~ 14705998 (-)
LOC113533171 NA coding upstream 698594 14709122 ~ 14725998 (-)
G319975 NA non-coding downstream 60186 13948308 ~ 13949723 (-)
G319974 NA non-coding downstream 64560 13940611 ~ 13945349 (-)
G319906 NA non-coding downstream 175111 13831855 ~ 13834798 (-)
G319766 NA non-coding downstream 380452 13629247 ~ 13629457 (-)
G319754 NA non-coding downstream 422378 13587091 ~ 13587531 (-)
G319999 NA non-coding upstream 1674 14012202 ~ 14012408 (-)
G320007 NA non-coding upstream 8965 14019493 ~ 14019979 (-)
G320215 LOC108280210,LOC101061753,LOC107092304,LOC107596267 non-coding upstream 17769 14028297 ~ 14028720 (-)
G320217 NA non-coding upstream 30425 14040953 ~ 14041176 (-)
G320218 NA non-coding upstream 32359 14042887 ~ 14043198 (-)
LOC113533556 LOC108280202 other downstream 329799 13665181 ~ 13680110 (-)
ccl25a NA other downstream 394166 13612516 ~ 13615743 (-)
LOC113533649 LOC108280860,LOC108433106 other downstream 1081838 12908453 ~ 12928071 (-)
wu:fb63a08 LOC108280878 other downstream 2304032 11619876 ~ 11705877 (-)
ccl20a.3 LOC108261059 other downstream 3481630 10527282 ~ 10528279 (-)
theg NA other upstream 721206 14731734 ~ 14745487 (-)
LOC113533479 LOC108280451 other upstream 1212250 15222778 ~ 15231580 (-)
LOC113533563 NA other upstream 1676554 15687082 ~ 15724356 (-)
G321462 NA other upstream 2347046 16357574 ~ 16367004 (-)
stk11 stk11 other upstream 2554180 16564708 ~ 16587816 (-)

Expression


Co-expression Network