sft2d3 (sft2d3)


Basic Information

Item Value
gene id sft2d3
gene name sft2d3
gene type coding
species striped catfish (Pangasianodon hypophthalmus)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_047615.1
NCBI id CM018561.1
chromosome length 21248730
location 18488627 ~ 18489656 (+)
genome version GENO_Phyp_1.0_2019_striped_catfish_Genome

Sequence

>XM_026946310.2
AGCGACCAAAGTGGACCGGTCGCGTTTTTATGACGTATCACTTACTGTTTGGGTTCCAACGCAACAATCATGGCGGAGTTAAACCGACAGCTTCAGGAATATTTAGCCCAGTCTAAGAGCGGTGCAAAGACAATATCGCAGTCGAGCTCCAGCACTACAGTGAACATCGATGAAGCCGACAGCAGTGTTCCGGGCAGCTGGTTCGGTCGGTGGTCGAGTCCGTTCTCGGGTCGCGGCGGATCCTCCACAGGCCCGAGCTCGAGCAGCGGGTTTTCCTGGCCGTGGTCTGCGGAACCCGATCCGTGTCTGCCGGGCGTGAGTCGGTCTCAGCGGCTGGTCGCATTCGGGGTGTGTATCTTGTTTTCGGCGCTGTGTTTCGGGCTCTCGGCTCTGTATGCGCCGCTGCTGTTACTGAAGGCGAGGAAATTCGCTCTGCTGTGGTCGCTCGGCTCGCTTTTCGCGCTGACCGGCGCCGCCGTCCTGCGCGGTCCGAGCCGCATGATCGCCGCCCCGTCCCCGGGGGCCGTGATATACCTGTGCTCGCTGGGGGCGACGCTGTACGCGGCGCTGGGGCTCCACAGCACCATGCTCACGGCGCTCGGAGCCATCGTGCAGATCGGCGCTATAGTGGGCTACGTGGTGTCTCTGGTGCCCGGTGGCAGCGCGGGGATGAGGTTTGTCGGCGGAATGGCTGCATCAGCCATCAAAAGGACAGTGACCGGCAAAACCATGCCCATATGAGCACAACTTTCGGACAAAATACAGGACTAAACACTAATCCGGTGTGCAGGAAGAATGTGTTTTAAATCTTGGGATGCTTCGTGTATTAATCTGGTGTGCAGATTACCAGTGTGTAGTCCTGGAAGCACTCATCAGCTGCTGTGATGAATAGGCTGGTTTCTGCATTTATCTGGATTAACTGCAGACTAATTCAGATTGTTCTACTGTGAAATGAGAGGACCAAAGCAGTACTTACGCACATCTAACAGATTTTGTGACATTGTAAATAAAGTCATGGACATTAACAGTG

Function

symbol description
sft2d3 Predicted to act upstream of or within protein transport and vesicle-mediated transport. Predicted to be located in Golgi membrane. Predicted to be integral component of membrane. Orthologous to human SFT2D3 (SFT2 domain containing 3).

NR:

description
vesicle transport protein SFT2C

GO:

id name namespace
GO:0016192 vesicle-mediated transport biological_process
GO:0016021 integral component of membrane cellular_component

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
XM_026946310.2 True 1030 mRNA 0.56 1 18488627 18489656

Neighbor

gene id symbol gene type direction distance location
si:ch1073-184j22.1 LOC108280744,LOC108440865,LOC107653514,LOC107564249,LOC107660327,LOC107705312 coding upstream 10990 18454136 ~ 18477637 (+)
gnb4a gnb4,LOC108280743,LOC108440866,LOC103030165,LOC107705311,LOC107653516,LOC107564248,LOC105899196,LOC107724752 coding upstream 39549 18435349 ~ 18449078 (+)
bambib LOC108280666,LOC108430169 coding upstream 493949 17990725 ~ 17994678 (+)
wacb LOC108280665 coding upstream 509505 17965893 ~ 17979122 (+)
rab18b rab18,rab18b,LOC108430170,LOC107566717,LOC107708473,LOC107681801,LOC107691240,LOC107550439 coding upstream 616598 17860311 ~ 17872029 (+)
dusp28 dusp28 coding downstream 28272 18517928 ~ 18520990 (+)
LOC113546359 LOC108280706 coding downstream 54249 18543905 ~ 18546163 (+)
crfb16 NA coding downstream 72442 18562098 ~ 18572503 (+)
mb21d2 mb21d2,LOC107705301,LOC107572431,LOC107673980 coding downstream 84724 18574380 ~ 18582220 (+)
fgf12a fgf12a,fgf12,LOC108280711,LOC108436038,LOC106568709,LOC105006885,LOC106598267,LOC103365152,LOC107549734 coding downstream 95407 18585063 ~ 18637704 (+)
G322462 NA non-coding upstream 48761 18439167 ~ 18439866 (+)
G322446 NA non-coding upstream 55925 18432326 ~ 18432702 (+)
G322429 NA non-coding upstream 114744 18370727 ~ 18373883 (+)
G322405 NA non-coding upstream 145137 18338329 ~ 18343490 (+)
G322398 NA non-coding upstream 257164 18229395 ~ 18231463 (+)
G322696 NA non-coding downstream 225739 18715395 ~ 18720439 (+)
G322738 NA non-coding downstream 275536 18765192 ~ 18765602 (+)
G322744 NA non-coding downstream 321449 18811105 ~ 18812335 (+)
G322746 NA non-coding downstream 322847 18812503 ~ 18812848 (+)
G322747 NA non-coding downstream 324958 18814614 ~ 18814817 (+)
pex5lb pex5lb,LOC108280742,LOC108440867,LOC107653517,LOC107564246,LOC107660316 other upstream 58605 18394023 ~ 18430022 (+)
si:ch211-162e15.3 LOC108280563 other upstream 261394 18225921 ~ 18227233 (+)
npc1 npc1 other upstream 822414 17589072 ~ 17666213 (+)
egfra egfr,LOC107747514,LOC107691124 other upstream 852018 17570649 ~ 17636609 (+)
fuz fuz other upstream 1004950 17478834 ~ 17483677 (+)
slc44a5a slc44a5,slc44a5a,LOC108280730 other downstream 326353 18816009 ~ 18871360 (+)
ssbp3a ssbp3,ssbp3a other downstream 455042 18944698 ~ 18985082 (+)
gng12a gbg12,gng12a,gng12,LOC107705318,LOC107700509,LOC105895117 other downstream 715002 19204658 ~ 19220229 (+)
LOC113546339 NA other downstream 824204 19313860 ~ 19316206 (+)
clcn2a clcn2a,clcn2,LOC108280323,LOC107710554,LOC107732945 other downstream 1639597 20129253 ~ 20281067 (+)

Expression


Co-expression Network