G334470 (zfhx4)


Basic Information

Item Value
gene id G334470
gene name zfhx4
gene type non-coding
species striped catfish (Pangasianodon hypophthalmus)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_047616.1
NCBI id CM018562.1
chromosome length 21037487
location 18749395 ~ 18749913 (-)
genome version GENO_Phyp_1.0_2019_striped_catfish_Genome

Sequence

>TU396115
GGTCTCGGCTTGAGGGCAGTCCTTGATGAAGAAGATCTCGGCGAGGTTGTCCTCCTCCAGCGGCAGACCTTGCTGGTGCAGCTGCAGCTTCCTCAGTCCTTCGTTCTGCTGGTGCTTGAGCGAACGTTGGTGTTGCACCAGGTTCAGCTTGGCTTTGCTTGAGTAGTCACACAGCGCGCAGTAGAAGGAGCACGAGTCCGAGCTGCACGCGCTCTCCTGTTTTTGCAAGTGCTTTCCCTTAATAATCTCCCTGACATGAAATGCATTCCTTCCATCTTTGTGCAAACATAAATACTGATAACAAAGAGAGATTGTGAAAGTCCCCCTGTGCTTCACAGAGGCCGTCTGATGAAGAAAGACAGAC

Function

symbol description
zfhx4 Predicted to enable DNA-binding transcription factor activity, RNA polymerase II-specific and RNA polymerase II cis-regulatory region sequence-specific DNA binding activity. Predicted to be involved in regulation of transcription by RNA polymerase II. Predicted to act upstream of or within regulation of transcription, DNA-templated. Predicted to be active in nucleus. Is expressed in brain; midbrain neural keel; pharyngeal arch; and retinal ganglion cell layer. Orthologous to human ZFHX4 (zinc finger homeobox 4).

NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU396115 True 364 lncRNA 0.52 2 18749395 18749913

Neighbor

gene id symbol gene type direction distance location
cops5 cops5,LOC107590195,LOC107705241,LOC107663714 coding downstream 247313 18496163 ~ 18502082 (-)
ppp1r42 ppp1r42 coding downstream 258814 18483387 ~ 18490581 (-)
LOC113541285 tcf24 coding downstream 266995 18479679 ~ 18482400 (-)
crhb LOC108256093 coding downstream 356417 18391371 ~ 18392978 (-)
trnay-gua_4 NA coding downstream 369661 18379649 ~ 18379734 (-)
pex2 pex2 coding upstream 58681 18808594 ~ 18816074 (-)
ankrd33ba LOC108256627 coding upstream 613486 19363399 ~ 19377873 (-)
ropn1l ropn1l coding upstream 632575 19382488 ~ 19391533 (-)
hgd hgd,LOC107705246,LOC107721894 coding upstream 645986 19395899 ~ 19411215 (-)
pola1 pola1,LOC107705179,LOC107666635,LOC107721886,LOC107663691 coding upstream 689850 19439763 ~ 19489383 (-)
G334427 NA non-coding downstream 164160 18584763 ~ 18585235 (-)
G334426 NA non-coding downstream 165083 18583602 ~ 18584312 (-)
G334425 NA non-coding downstream 166370 18582473 ~ 18583025 (-)
LOC113541286 NA non-coding downstream 270602 18474666 ~ 18478793 (-)
G334248 sgk3,LOC107721888,LOC107663688,LOC107705243 non-coding downstream 284841 18461956 ~ 18464554 (-)
G334471 NA non-coding upstream 5957 18755870 ~ 18759552 (-)
G334467 zfhx4 non-coding upstream 35579 18785492 ~ 18789747 (-)
G334570 NA non-coding upstream 180066 18929979 ~ 18930439 (-)
G334574 NA non-coding upstream 182716 18932629 ~ 18932840 (-)
G334602 NA non-coding upstream 210934 18960847 ~ 18961053 (-)
mybl1 mybl1,LOC107663687,LOC107590196 other downstream 229190 18437514 ~ 18520205 (-)
zmp:0000000991 NA other downstream 817581 17916084 ~ 17931814 (-)
c22h11orf65 c23h11orf65 other downstream 832839 17909324 ~ 17916556 (-)
LOC113541127 LOC108256571 other downstream 840583 17907584 ~ 17908812 (-)
vipr1b vipr1,vipr1b,LOC108256372,LOC107733233,LOC107754936 other downstream 1510279 17185524 ~ 17239116 (-)
pkia pkia,LOC107666628,LOC107705234 other upstream 255585 19005498 ~ 19015855 (-)
pdk3a pdk3,pdk3a,LOC107586717,LOC107705263,LOC107656160,LOC107663620,LOC107590342,LOC107721912 other upstream 757175 19507088 ~ 19521331 (-)
nup58 nup58,LOC107721897,LOC107590217 other upstream 805228 19555141 ~ 19579031 (-)
G335165 amer2 other upstream 850814 19600727 ~ 19603693 (-)
cnksr2a cnksr2,cnksr2a other upstream 1139126 19889039 ~ 19967804 (-)

Expression


Co-expression Network