G371147 (ercc5)


Basic Information

Item Value
gene id G371147
gene name ercc5
gene type non-coding
species striped catfish (Pangasianodon hypophthalmus)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_047620.1
NCBI id CM018566.1
chromosome length 19313417
location 5993489 ~ 5994747 (-)
genome version GENO_Phyp_1.0_2019_striped_catfish_Genome

Sequence

>TU439680
GTTGGTGCATCCATGACCACATAGTCTATTGGGGAATAAAGTGTCTTCTGATTGTGACCCTGGTGATTCTCATTGCTCTTGGTGGTTAGAAGTGGTAAAATAGACCAGCAGCATTGAAAGTTTTTATACAGGCTGAGATAAATACAGTCTATACAATAGAAAGTCTTTACCTGTTGAGTGCTGAGCTGTTTTAATACTGGCTGAAGAGTTTCTTCAGTCTTCTTGCTGTTCCAACCAAATCGACTATAAGCAAAATCTTTGAGGAGATCCAGCTGTGGGCGGCCCCAGCAAAAGGAGCCCTCTGATTGGTCCACAGTGGGCTGGAGGTAGGCCTCAGCGACAGCAGGGTTGGGGAAGCCTGGATGAAGATTCAAGGCTCTTAGCTTTTTCTTCACCTTTGTGTCCTTAGGATCAGCTGCCAGCTTCTTATTGGTTTGAGCTTCGTTCCACCACTTACTGTAGTAGCCAGAGGACAAGAGAGTATTACTGCTACTTACTGAGAGAAGGGACATGTCAAATTTATGTGTTTTCTCTGTATTAGCAGTGTAATC

Function

symbol description
ercc5 Predicted to enable endodeoxyribonuclease activity and single-stranded DNA binding activity. Predicted to be involved in nucleotide-excision repair, DNA incision, 3'-to lesion. Predicted to act upstream of or within nucleotide-excision repair. Predicted to be active in nucleus. Human ortholog(s) of this gene implicated in cerebrooculofacioskeletal syndrome 3; melanoma; and xeroderma pigmentosum group G. Orthologous to human ERCC5 (ERCC excision repair 5, endonuclease).

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU439680 True 551 lncRNA 0.44 2 5993489 5994747

Neighbor

gene id symbol gene type direction distance location
blzf1 blzf1 coding downstream 9692 5976377 ~ 5983797 (-)
txnl4b txnl4b coding downstream 20050 5971040 ~ 5973439 (-)
mrpl16 mrpl16 coding downstream 24424 5963752 ~ 5969065 (-)
mrpl39 mrpl39 coding downstream 73290 5913959 ~ 5920199 (-)
jam2a jam2 coding downstream 84622 5896336 ~ 5908867 (-)
LOC113537602 tmem255b coding upstream 141760 6136507 ~ 6160962 (-)
cenpe cenpe,LOC107751066,LOC107573438 coding upstream 167367 6162114 ~ 6190394 (-)
grk1a grk1,grk1a,LOC107748333 coding upstream 196881 6191628 ~ 6200180 (-)
tfdp1b tfdp1 coding upstream 208950 6203697 ~ 6222555 (-)
tmco3 tmco3 coding upstream 231306 6226053 ~ 6238578 (-)
G371121 NA non-coding downstream 97801 5892326 ~ 5895688 (-)
LOC117596178 NA non-coding downstream 101692 5886846 ~ 5891797 (-)
G371117 NA non-coding downstream 107877 5880476 ~ 5885612 (-)
LOC117596170 NA non-coding downstream 475109 5510716 ~ 5518380 (-)
G370942 NA non-coding downstream 485120 5508102 ~ 5508369 (-)
G371152 NA non-coding upstream 3256 5998003 ~ 5998159 (-)
G371153 NA non-coding upstream 4101 5998848 ~ 5999474 (-)
G371135 NA non-coding upstream 6432 6001179 ~ 6001613 (-)
G371134 mettl21c,LOC108429839 non-coding upstream 7091 6001838 ~ 6004790 (-)
G371454 NA non-coding upstream 534650 6529397 ~ 6536004 (-)
LOC113537623 NA other downstream 41176 5942039 ~ 5952313 (-)
LOC113537235 son,LOC107698912,LOC107709257,LOC107698212,LOC107571887,LOC107555269,LOC565999 other downstream 446457 5529992 ~ 5547032 (-)
LOC113537294 NA other downstream 598477 5388904 ~ 5395012 (-)
G370658 NA other downstream 1104108 4843329 ~ 4889381 (-)
LOC117596167 NA other downstream 3140278 2843212 ~ 2853211 (-)
tpp2 tpp2,si:ch73-244f7.4,LOC107665822 other upstream 20979 6015726 ~ 6033393 (-)
LOC113537742 LOC108258591 other upstream 363892 6358639 ~ 6363203 (-)
pspc1 pspc1,LOC108258933,LOC108434730 other upstream 875819 6870566 ~ 6910546 (-)
LOC113537271 LOC108258282 other upstream 1064088 7058835 ~ 7068531 (-)
LOC113537388 arhgap6 other upstream 1362524 7357271 ~ 7478509 (-)

Expression


Co-expression Network