G373296 (neurl1,LOC103384027)


Basic Information

Item Value
gene id G373296
gene name neurl1,LOC103384027
gene type non-coding
species striped catfish (Pangasianodon hypophthalmus)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_047620.1
NCBI id CM018566.1
chromosome length 19313417
location 9767039 ~ 9767482 (-)
genome version GENO_Phyp_1.0_2019_striped_catfish_Genome

Sequence

>TU442121
CTGACCCAGTGTTCTATCTCTGCCTTTCCTTTTATGTGGGTGAGAAGCAACAATGTGATATGCAAAAGACTGTCTAGGCATGAGGCAAGCCTGTAGTGAACACCTACAGTTCGGTGTGTGACTCACCAAGCAGCTGGACTCCTCGAGTCAGGCCATAGACGTCGATGAGTGCCCAGAGGGTTTCGTTGGTGCGCACGCCGCTGAAGAATAGCATGGGACTGGAGCCGTTGACGCGGTAGAACACGCGGCCCTTCTTGTCCACCCAGAAGGCGACGAGGTTGCCCTCATTGGCTAGCTCCTCGGGCAGTGCCTTGGCCCAGAAACCATTCTGAGACACCAGGTCTGGGCACGCGTACTTAGGCAGGCTGTCTGGGTTGATACGTGATGGGTCTTTGGAGGTGAAGCCCAGGCGCAGAGCACCACTCCAACAACACTGCTTCTTTG

Function

symbol description
neurl1 Predicted to enable translation factor activity, non-nucleic acid binding and ubiquitin protein ligase activity. Involved in negative regulation of Notch signaling pathway; negative regulation of cell population proliferation; and positive regulation of apoptotic process. Located in plasma membrane.

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU442121 True 444 lncRNA 0.56 1 9767039 9767482

Neighbor

gene id symbol gene type direction distance location
cfap58 cfap58 coding downstream 61213 9597014 ~ 9705826 (-)
sorcs3 LOC108258285,LOC108443686,LOC107746061,LOC107566138,LOC107684317,LOC105891017,LOC103472494,LOC106951909 coding downstream 219782 9306733 ~ 9547257 (-)
caly caly,LOC108258305,LOC108434710,LOC103039857,LOC105891014 coding downstream 918875 8835487 ~ 8848164 (-)
msx1b LOC108258334 coding downstream 968791 8796367 ~ 8798248 (-)
taf5 taf5,LOC107583167,LOC107684290,LOC107676012 coding downstream 1014789 8743452 ~ 8752250 (-)
sh3pxd2aa sh3pxd2a coding upstream 39690 9807172 ~ 9823708 (-)
stn1 obfc1 coding upstream 152340 9919822 ~ 9927977 (-)
lrrc58a LOC108258943,LOC108428195,LOC107566531 coding upstream 163967 9931449 ~ 9937173 (-)
fstl1a LOC108258944,LOC108428196,LOC103028151,LOC106575075,LOC105019681 coding upstream 171814 9939296 ~ 9961370 (-)
gja8b gja8,cx44.1,LOC108258942,LOC107566539 coding upstream 200969 9968451 ~ 9970159 (-)
G373292 neurl1,LOC107676877,LOC107746052 non-coding downstream 2513 9763619 ~ 9764526 (-)
G373288 NA non-coding downstream 7090 9759741 ~ 9759949 (-)
LOC113537261 NA non-coding downstream 801418 8963585 ~ 8965621 (-)
G372742 NA non-coding downstream 978898 8775032 ~ 8788141 (-)
G372522 NA non-coding downstream 1322974 8428604 ~ 8444065 (-)
G373310 neurl1 non-coding upstream 18501 9785983 ~ 9786861 (-)
G373316 NA non-coding upstream 24800 9792282 ~ 9792621 (-)
G373303 neurl1,neurl1aa,LOC107676877,LOC107746293,LOC107746052 non-coding upstream 25887 9793369 ~ 9799910 (-)
G373317 NA non-coding upstream 57979 9825461 ~ 9825693 (-)
G373327 NA non-coding upstream 64125 9831607 ~ 9832325 (-)
tsga10 LOC108258346 other downstream 1156198 8591407 ~ 8610841 (-)
LOC113537606 nhlh2,LOC108258389,LOC103035065,LOC108434665,LOC107739819,LOC105019883 other downstream 1334601 8429562 ~ 8432438 (-)
timmdc1 timmdc1 other downstream 1438013 8320868 ~ 8329026 (-)
LOC113537489 NA other downstream 1499767 8261435 ~ 8267272 (-)
cars2 cars2 other downstream 1682500 8069402 ~ 8084539 (-)
LOC117596103 LOC102201964,LOC102304430 other upstream 111361 9878843 ~ 9918779 (-)
cab39l cab39l,LOC107676861,LOC107718429 other upstream 654670 10422152 ~ 10435367 (-)
lipt1 lipt1 other upstream 1103742 10871224 ~ 10872556 (-)
mzt1 mzt1,si:dkey-15d12.2,LOC107556706 other upstream 2311409 12078891 ~ 12084049 (-)
LOC113537246 NA other upstream 2857569 12625051 ~ 12630403 (-)

Expression


Co-expression Network