G398135 (LOC107387363)



Basic Information


Item Value
gene id G398135
gene name LOC107387363
gene type non-coding
species striped catfish (Pangasianodon hypophthalmus)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_047623.1
NCBI id CM018569.1
chromosome length 15305753
location 107329 ~ 107775 (-)
genome version GENO_Phyp_1.0_2019_striped_catfish_Genome

Sequence


>TU472201
CTTTGTGCTTACATCAATGATGCTTGGTGCCGTGACGCTGTTGTGGTCTGCAGACACTGTTCACCCCTGGCGGAGTTCACGATTATTAAGTGCCGTCCGTTCTATCTACCGAGGGAATATACAGCCATACTGCTCGTTGCTGTATACATCCCTCCCAGCTCCAGTAACAACAACAGGAGTGAGGCACTGAATGAACTATACCAGCACATCAGTGAGCAGCAGACATCTTGGCTGGGGATTTCAACCATGCAGACCTAAAGAGTGTGTTTCCTAAAATATATCAACACATAGACTTTCCAACTAGGGGAAACAACATACTGGACTTTGTTTACACCACCCAGAGTGGAGCTTACAAGGCTCTTCCCTTCCCCCACCTTGGTGCCTCAGACCACATCACTGTCATGCTAATGCCTGCATACAGACCG

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU472201 True 425 lncRNA 0.48 2 107329 107775
Loading

Neighbor


gene id symbol gene type direction distance location
LOC117596420 NA coding upstream 39153 146928 ~ 287137 (-)
plbd1 plbd1 coding upstream 190986 298761 ~ 310236 (-)
LOC113525084 LOC108272484 coding upstream 221086 328861 ~ 339349 (-)
LOC113525087 LOC108272484 coding upstream 233296 341071 ~ 350569 (-)
LOC113525089 LOC108272484 coding upstream 265368 373143 ~ 399186 (-)
G398140 NA non-coding upstream 62057 169832 ~ 193133 (-)
LOC117596423 NA non-coding upstream 197298 305073 ~ 305873 (-)
G398158 NA non-coding upstream 199343 307118 ~ 307409 (-)
trnar-ccu_18 NA non-coding upstream 202808 310583 ~ 310655 (-)
LOC117596419 NA non-coding upstream 306690 414465 ~ 417319 (-)
pick1 pick1 other upstream 204633 312408 ~ 325545 (-)
LOC117596396 NA other upstream 365975 473750 ~ 482008 (-)
LOC117596444 smdt1 other upstream 632468 740243 ~ 890302 (-)
fam234b fam234b other upstream 784145 891920 ~ 906375 (-)
LOC117596481 NA other upstream 799850 907625 ~ 907779 (-)

Expression


G398135(LOC107387363) Expression in all Baseline Samples

Bar chart with 27 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

G398135(LOC107387363) Expression in each Bioproject

Bar chart with 2 bars.
G398135(LOC107387363) Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 60.
End of interactive chart.

Co-expression Network