Fish Transcriptome and Expression Database

Home /
Search /
- Gene
- RNA
- Bioproject
Expression /
Analysis /
- Coding ability prediction
- Expression count
- Visual Omics
Tools /
- Neighbor
- BLAST
Statistics /
Download /
Help

economic fish

G406079

Basic Information

Item	Value
gene id	G406079
gene name	NA
gene type	non-coding
species	striped catfish (Pangasianodon hypophthalmus)
category of species	economic fish

Chromosome Information

Item	Value
chromosome id	NC_047623.1
NCBI id	CM018569.1
chromosome length	15305753
location	15257725 ~ 15257945 (-)
genome version	GENO_Phyp_1.0_2019_striped_catfish_Genome

Sequence

>TU481741
AATATTCATGTGGACCAAAGTGACTCTGCAATGGCTAAGGAATTTCTATCATTACTGGACTGTTTTAACTTTTCACAACTGGTAACAAGTCCGACGCACTGCAAAGGTCATACACTGGATCTTGTGCTTACAAATGGCTCATTTGCATCTCAGTTATCATCAGTGGACATTGGTCTGTCAGACCACTCAGCTGTCTTCTTTAACTTGGAATTACATCGATC

Function

GO: NA

KEGG:

id	description
ko05320	Autoimmune thyroid disease
ko05321	Inflammatory bowel disease
ko05330	Allograft rejection
ko05332	Graft-versus-host disease
ko04940	Type I diabetes mellitus

RNA

RNA id	representative	length	rna type	GC content	exon number	start site	end site
TU481741	True	221	lncRNA	0.41	1	15257725	15257945

Notice the +/- strand.
Display format: symbol/gene id: RNA id. (Except when gene id is similar to RNA id.)
You can browse transcripts by dragging.
A more detailed transcript can be viewed by the zoom button in the upper right corner.

Neighbor

gene id	symbol	gene type	direction	distance	location
atp1a3a	LOC108433742,LOC108272709,LOC102313318,LOC102779181,LOC103362864,LOC100707930	coding	downstream	50774	15165188 ~ 15206951 (-)
LOC113534955	LOC108272455,LOC108433744,LOC107753802	coding	downstream	120935	15073669 ~ 15136790 (-)
cica	LOC108272903,LOC108433746	coding	downstream	292914	14931143 ~ 14964811 (-)
si:ch211-264f5.6	NA	coding	downstream	339808	14897610 ~ 14917917 (-)
gnb3b	gnb3b,LOC108433753,LOC107666347,LOC107665150,LOC107753988,LOC107727720,LOC107563025	coding	downstream	390127	14860254 ~ 14867598 (-)
G406078	NA	non-coding	downstream	671	15256802 ~ 15257054 (-)
G406054	NA	non-coding	downstream	50194	15207201 ~ 15207531 (-)
G405983	NA	non-coding	downstream	204881	15052587 ~ 15052844 (-)
G405982	NA	non-coding	downstream	205537	15051955 ~ 15052188 (-)
G405981	NA	non-coding	downstream	205828	15051689 ~ 15051897 (-)
G406083	NA	non-coding	upstream	13728	15271673 ~ 15272249 (-)
G406086	NA	non-coding	upstream	15063	15273008 ~ 15273429 (-)
G405961	NA	other	downstream	243737	14967476 ~ 15013988 (-)
tpbga	LOC108272337	other	downstream	778648	14475476 ~ 14479077 (-)
G405588	NA	other	downstream	1138067	14114619 ~ 14119658 (-)
npy	npy	other	downstream	1173879	14081372 ~ 14083846 (-)
s100a11	s10ab,LOC105901467,LOC102790362,LOC105028986,LOC106570111	other	downstream	1496168	13759761 ~ 13761557 (-)

Expression

Co-expression Network