AMCG00000070 (tmem229b,LOC107752730,LOC107708331,LOC102785226)


Basic Information

Item Value
gene id AMCG00000070
gene name tmem229b,LOC107752730,LOC107708331,LOC102785226
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030141.1
NCBI id CM030141.1
chromosome length 22147039
location 2114661 ~ 2115167 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00000070
ATGATGGCTGCCCCAGAGCCCCTGACGGCCCTGTCGAGATGGTACCTGTACGCCATCCATGGGTACTTCTGCGAGGTGATGTTCACAGCTGCCTGGGAGTTTGTGGTCAATTACAACTGGAAGTTCCCTGGTGTGACCAGCGTGTGGGCCCTGTTCATCTATGGCACTTCCATCCTGATCGTGGAGCGCATGTACCTGCGGCTGAAGGACCGCTGCCACATCCTGCTACGCTGTCTCATCTACACGCTATGGACATACGTATGGGAATTCAGCACAGGTCTGCTCCTGCGCCAGTTCAACGCCTGCCCCTGGGACTACTCAGAGTTCGACTATGACTTCATGGGCCTCATCACACTGGAGTACTCCCTGCCCTGGTTCTGCGCTTCCTTCATTGTGGAGCAGCTGGTCATCAGGAACACCCTTAGGCTGCGTTTCGATGAGAAGGCCGATCCGAGCGCCGCCATGGCAACTGGCGGAATGGCTAATGGCTACGTGAAGGTCAACTGA

Function

symbol description
tmem229b Predicted to be located in membrane. Predicted to be integral component of membrane. Is expressed in cranial ganglion; epiphysis; hatching gland; hindbrain; and neurons. Orthologous to human TMEM229B (transmembrane protein 229B).

NR:

description
PREDICTED: transmembrane protein 229b

GO:

id name namespace
GO:0016021 integral component of membrane cellular_component

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00000070 True 507 mRNA 0.57 1 2114661 2115167

Neighbor

gene id symbol gene type direction distance location
AMCG00000072 mta1,LOC102776995,LOC107741866,LOC107666257 coding upstream 80019 2013547 ~ 2034642 (+)
AMCG00000067 NA coding upstream 253917 1860508 ~ 1860744 (+)
AMCG00000066 NA coding upstream 332890 1740809 ~ 1781771 (+)
AMCG00000057 NA coding upstream 395055 1693152 ~ 1719606 (+)
AMCG00000056 NA coding upstream 731607 1361377 ~ 1383054 (+)
AMCG00000071 NA coding downstream 13417 2128584 ~ 2135898 (+)
AMCG00000074 LOC106602716,LOC107752725 coding downstream 457612 2572779 ~ 2607991 (+)
AMCG00000086 slc25a21,LOC107679800 coding downstream 661500 2776667 ~ 2790487 (+)
AMCG00000088 NA coding downstream 724748 2839915 ~ 2841035 (+)
AMCG00000085 nkx2.1,nkx2-1,LOC107679765,LOC107666245,LOC107582966,LOC107578306 coding downstream 742986 2858153 ~ 2860184 (+)
G147635 crip1,LOC107600860,LOC103034058,LOC106611282 non-coding upstream 285118 1820357 ~ 1829543 (+)
G147580 NA non-coding upstream 494586 1619172 ~ 1620075 (+)
G147579 NA non-coding upstream 498710 1613310 ~ 1615951 (+)
G147565 NA non-coding upstream 526366 1588077 ~ 1588295 (+)
G147564 NA non-coding upstream 528337 1586057 ~ 1586324 (+)
G147688 NA non-coding downstream 175973 2291140 ~ 2358137 (+)
G147689 LOC107575789 non-coding downstream 186320 2301487 ~ 2368445 (+)
G147687 NA non-coding downstream 234874 2350041 ~ 2354058 (+)
G147735 NA non-coding downstream 363543 2478710 ~ 2478958 (+)
G147739 NA non-coding downstream 410024 2525191 ~ 2525421 (+)
AMCG00000073 mta1,LOC107679789,LOC107666257,LOC107600838 other upstream 55891 2036023 ~ 2058770 (+)
G147416 NA other upstream 997711 1063085 ~ 1116950 (+)
G147311 NA other upstream 1616150 449652 ~ 498511 (+)
AMCG00000032 NA other upstream 1860220 231336 ~ 254441 (+)
AMCG00000025 NA other upstream 2010299 55439 ~ 104362 (+)
G147726 LOC104962440 other downstream 288563 2403730 ~ 2403972 (+)
AMCG00000094 NA other downstream 1575605 3690772 ~ 3699093 (+)
AMCG00000093 srp14,LOC106610862 other downstream 1605818 3720985 ~ 3724316 (+)
G148040 NA other downstream 1645012 3760179 ~ 3760624 (+)
AMCG00000113 NA other downstream 1996953 4112120 ~ 4193033 (+)

Expression


Co-expression Network