AMCG00000179 (inf2)


Basic Information

Item Value
gene id AMCG00000179
gene name inf2
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030141.1
NCBI id CM030141.1
chromosome length 22147039
location 6067655 ~ 6069832 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00000179
ATGTCAGCCCAGAAGAAATGGGCTGCCCTCAAGCACCGGCTGAGCAGCTCCCAGGAACCCGACTCCCAGCTGGAGGCCAACCTGGAGAACGCTGATCCCGAGCTGTGCATCCGGCTGCTGCAGGTGCCCACAGTGGTCAACTACTCTGGGCTGAAGCGGCGGCTGGAGGGCAGTGACCAGGCCTGGATGGTGCAGTTCTTGGAGCTCAATGGCCTGGACCTCCTCTTGGAGGCCCTGGACCGCCTCTCCGGACGGGGCTGCTCCCGCATTGCTGACGCCCTGCTGCAGCTCACCTGCGTCAACTGCGTGCGCGCCGTCATGAATTCCTCCTGCGGCATCAACTTCATTGTGGAGAACGAGGGCTACGTCCGCAAGCTGTCGCAAGCTCTGGACACCTCAAACACAATGGTGAAGAAGCAGGTCTTTGAGCTGCTGGCTGCTCTCTGTATGTACTCTGCTGATGGGCACAACTTGGCCTTAGATGCTCTGGAACATTACAAGGCAAGTATGACACACTGCCCACAACTGTAG

Function

symbol description
inf2 Acts upstream of or within several processes, including glomerular filtration; glomerular visceral epithelial cell development; and slit diaphragm assembly. Is expressed in several structures, including blood vessel; digestive system; eye; pronephros; and somite. Used to study glomerulosclerosis. Human ortholog(s) of this gene implicated in Charcot-Marie-Tooth disease dominant intermediate E and focal segmental glomerulosclerosis 5. Orthologous to human INF2 (inverted formin 2).

NR:

description
PREDICTED: inverted formin-2 isoform X3

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00000179 True 531 mRNA 0.60 2 6067655 6069832

Neighbor

gene id symbol gene type direction distance location
AMCG00000176 chp1 coding downstream 37859 6017546 ~ 6029796 (-)
AMCG00000178 NA coding downstream 66993 5992473 ~ 6000662 (-)
AMCG00000167 rtf1,LOC102785722 coding downstream 83082 5971780 ~ 5984573 (-)
AMCG00000172 NA coding downstream 245529 5791583 ~ 5822126 (-)
AMCG00000171 dcaf5,LOC102780996 coding downstream 276217 5767538 ~ 5791438 (-)
AMCG00000169 NA coding upstream 55962 6125794 ~ 6126360 (-)
AMCG00000188 rad51 coding upstream 174887 6244719 ~ 6258200 (-)
AMCG00000187 NA coding upstream 190788 6260620 ~ 6279544 (-)
AMCG00000191 NA coding upstream 215177 6285009 ~ 6288346 (-)
AMCG00000182 NA coding upstream 405609 6475441 ~ 6480300 (-)
G148486 NA non-coding downstream 355779 5711019 ~ 5711876 (-)
G148417 NA non-coding downstream 612166 5455246 ~ 5455489 (-)
G148416 NA non-coding downstream 613407 5451000 ~ 5454248 (-)
G148400 cdca4 non-coding downstream 687527 5377749 ~ 5380128 (-)
G148364 NA non-coding downstream 826972 5236868 ~ 5240683 (-)
G148610 NA non-coding upstream 78097 6147929 ~ 6148286 (-)
G148801 NA non-coding upstream 1070530 7140362 ~ 7140968 (-)
G148962 NA non-coding upstream 1688850 7758682 ~ 7758963 (-)
G149002 NA non-coding upstream 1886140 7955972 ~ 7956264 (-)
G149030 NA non-coding upstream 2233987 8303819 ~ 8304215 (-)
AMCG00000177 NA other downstream 471 6045665 ~ 6067184 (-)
AMCG00000180 NA other downstream 55018 6004186 ~ 6012637 (-)
G148395 NA other downstream 725164 5338809 ~ 5342491 (-)
AMCG00000161 NA other downstream 990409 5071467 ~ 5077246 (-)
AMCG00000084 zbtb42,LOC106582697,LOC106610857,LOC103136097,LOC102793331 other downstream 2508754 3552159 ~ 3558901 (-)
AMCG00000168 gchfr,LOC106583112 other upstream 80888 6150720 ~ 6154301 (-)
AMCG00000189 NA other upstream 137682 6207514 ~ 6209957 (-)
AMCG00000190 cyp1c1,cyp1c3,cyp1c2,LOC107745367,LOC106610849 other upstream 144173 6214005 ~ 6216441 (-)
G148692 LOC107756589,LOC107552947,LOC107682372,LOC100534413,LOC105015666 other upstream 486873 6556705 ~ 6563305 (-)
G148851 gpx2 other upstream 1291390 7361222 ~ 7362692 (-)

Expression


Co-expression Network