AMCG00000317 (LOC107733188,LOC106611223,LOC106602554,LOC108433921,LOC108270174)


Basic Information

Item Value
gene id AMCG00000317
gene name LOC107733188,LOC106611223,LOC106602554,LOC108433921,LOC108270174
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030141.1
NCBI id CM030141.1
chromosome length 22147039
location 10814984 ~ 10826988 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00000317
GCAGGGCCTGGGAAAAACCATGAGATGTTACGACGCAAAATAGAAAATGGCGTTAAGGAGCTGTGGTACTTTGTGAGAAGTGAATTAAAGAAGTTAACACACATGGAGGCGGGTGACCTCCAGAAACACACTGATGGATTACTAGAAGACCTGGGGCATCAGCAAAGGTCAATCATGACAGATCTGTACTACCTCAGCCAATCTGATGGAGCTGGCGATTGGAGAGAGAAGGAGGCTAAGGACCTGTCAGACCTGGTTCAGAATAGAATAACATACCTTCAGAACCCTAAGGATTGCAGCAAAGCCAGGAAGTTGGTGTGCAACATCAACAAGGGTTGTGGTTATGGCTGCCAACTCCACCATGTTGTCTACTGCTTCATGATTGCTTATGGAACCCAGAGAACTCTCATCCTGGAGTCTCAGAACTGGAGGTATGCCACCAGCGGCTGGGAGACCGTCTTCAAACCTGTTAGTGAGACCTGCATGGACAGGACCGGCACCTCCACTGGACACTGGTCAGGTAAGAACTGCTTAGTTGCCATTAGATTGACTGGGACAAGATCATGGTTTCAGTAG

Function

NR:

description
PREDICTED: alpha-(1,6)-fucosyltransferase-like

GO:

id name namespace
GO:0036071 N-glycan fucosylation biological_process
GO:0033578 protein glycosylation in Golgi biological_process
GO:0032580 Golgi cisterna membrane cellular_component
GO:0016021 integral component of membrane cellular_component
GO:0008424 glycoprotein 6-alpha-L-fucosyltransferase activity molecular_function

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00000317 True 576 mRNA 0.48 3 10814984 10826988

Neighbor

gene id symbol gene type direction distance location
AMCG00000316 LOC106571665 coding downstream 31261 10780110 ~ 10783723 (-)
AMCG00000295 LOC108443923,LOC108270253 coding downstream 521512 10278809 ~ 10293472 (-)
AMCG00000296 gphna,LOC107752769,LOC107657705 coding downstream 605756 10161709 ~ 10209228 (-)
AMCG00000299 NA coding downstream 687028 10125262 ~ 10127956 (-)
AMCG00000301 mpp5,LOC107657730,LOC107752770,LOC105026062,LOC107592802,LOC106611266 coding downstream 700174 10104501 ~ 10114810 (-)
AMCG00000318 NA coding upstream 31767 10858755 ~ 10861525 (-)
AMCG00000319 NA coding upstream 380461 11207449 ~ 11210136 (-)
AMCG00000320 NA coding upstream 393932 11220920 ~ 11221514 (-)
AMCG00000349 NA coding upstream 483771 11310759 ~ 11473260 (-)
AMCG00000322 NA coding upstream 809752 11636740 ~ 11637036 (-)
G149539 NA non-coding downstream 102303 10712477 ~ 10712681 (-)
G149532 NA non-coding downstream 220049 10594726 ~ 10594935 (-)
G149438 NA non-coding downstream 893962 9919912 ~ 9921022 (-)
G149414 NA non-coding downstream 917234 9894546 ~ 9897750 (-)
G149391 NA non-coding downstream 1067878 9744764 ~ 9747106 (-)
G149567 NA non-coding upstream 306413 11133401 ~ 11134191 (-)
G149573 NA non-coding upstream 348693 11175681 ~ 11176066 (-)
G149596 NA non-coding upstream 511403 11338391 ~ 11368231 (-)
G149603 NA non-coding upstream 610379 11437367 ~ 11437819 (-)
G149616 NA non-coding upstream 699882 11526870 ~ 11527092 (-)
AMCG00000300 NA other downstream 755984 10029727 ~ 10059000 (-)
G149441 NA other downstream 879434 9930970 ~ 9935550 (-)
G149402 NA other downstream 982851 9831755 ~ 9832133 (-)
G149395 NA other downstream 1048190 9756381 ~ 9766794 (-)
G149341 sos2 other downstream 1273725 9540611 ~ 9541259 (-)
AMCG00000334 NA other upstream 960101 11787089 ~ 11808825 (-)
AMCG00000336 NA other upstream 1013492 11840480 ~ 11847948 (-)
G149751 NA other upstream 1254555 12081543 ~ 12083214 (-)
G149847 NA other upstream 1695532 12522520 ~ 12542310 (-)
G150138 NA other upstream 2996966 13823954 ~ 13826709 (-)

Expression


Co-expression Network