AMCG00000318



Basic Information


Item Value
gene id AMCG00000318
gene name NA
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information


Item Value
chromosome id CM030141.1
NCBI id CM030141.1
chromosome length 22147039
location 10858755 ~ 10861525 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence


>AMCG00000318
ATGCTCATCCTGCTGGCTTGGGGGACATTGCTGTTCTACATTGGCGGCCATTTGGTCAAGGACAACGACCACCCAGACCGCTCTAGCAGGGAACTGTCCAAAATCCTGGCTAAGCTCGAGCGCTTGAAACAGCAGAATGAGGATCTCCGCAGAATGGCTGAGTCTTTAAGCTTTACCATGGCTGGATATATGGACCCTGACCCATAA

Function


GO:

id name namespace
GO:0036071 N-glycan fucosylation biological_process
GO:0033578 protein glycosylation in Golgi biological_process
GO:0032580 Golgi cisterna membrane cellular_component
GO:0016021 integral component of membrane cellular_component
GO:0008424 glycoprotein 6-alpha-L-fucosyltransferase activity molecular_function

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
AMCG00000318 True 207 mRNA 0.52 2 10858755 10861525

Neighbor


gene id symbol gene type direction distance location
AMCG00000317 LOC107733188,LOC106611223,LOC106602554,LOC108433921,LOC108270174 coding downstream 31767 10814984 ~ 10826988 (-)
AMCG00000316 LOC106571665 coding downstream 75032 10780110 ~ 10783723 (-)
AMCG00000295 LOC108443923,LOC108270253 coding downstream 565283 10278809 ~ 10293472 (-)
AMCG00000296 gphna,LOC107752769,LOC107657705 coding downstream 649527 10161709 ~ 10209228 (-)
AMCG00000299 NA coding downstream 730799 10125262 ~ 10127956 (-)
AMCG00000319 NA coding upstream 345924 11207449 ~ 11210136 (-)
AMCG00000320 NA coding upstream 359395 11220920 ~ 11221514 (-)
AMCG00000349 NA coding upstream 449234 11310759 ~ 11473260 (-)
AMCG00000322 NA coding upstream 775215 11636740 ~ 11637036 (-)
AMCG00000321 LOC105356882 coding upstream 801332 11662857 ~ 11669320 (-)
G149539 NA non-coding downstream 146074 10712477 ~ 10712681 (-)
G149532 NA non-coding downstream 263820 10594726 ~ 10594935 (-)
G149438 NA non-coding downstream 937733 9919912 ~ 9921022 (-)
G149414 NA non-coding downstream 961005 9894546 ~ 9897750 (-)
G149391 NA non-coding downstream 1111649 9744764 ~ 9747106 (-)
G149567 NA non-coding upstream 271876 11133401 ~ 11134191 (-)
G149573 NA non-coding upstream 314156 11175681 ~ 11176066 (-)
G149596 NA non-coding upstream 476866 11338391 ~ 11368231 (-)
G149603 NA non-coding upstream 575842 11437367 ~ 11437819 (-)
G149616 NA non-coding upstream 665345 11526870 ~ 11527092 (-)
AMCG00000300 NA other downstream 799755 10029727 ~ 10059000 (-)
G149441 NA other downstream 923205 9930970 ~ 9935550 (-)
G149402 NA other downstream 1026622 9831755 ~ 9832133 (-)
G149395 NA other downstream 1091961 9756381 ~ 9766794 (-)
G149341 sos2 other downstream 1317496 9540611 ~ 9541259 (-)
AMCG00000334 NA other upstream 925564 11787089 ~ 11808825 (-)
AMCG00000336 NA other upstream 978955 11840480 ~ 11847948 (-)
G149751 NA other upstream 1220018 12081543 ~ 12083214 (-)
G149847 NA other upstream 1660995 12522520 ~ 12542310 (-)
G150138 NA other upstream 2962429 13823954 ~ 13826709 (-)

Expression



Co-expression Network