AMCG00000322


Basic Information

Item Value
gene id AMCG00000322
gene name NA
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030141.1
NCBI id CM030141.1
chromosome length 22147039
location 11636740 ~ 11637036 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00000322
ATGAAGCTGATGTCATCTCCAGAGCTCGCCACCACTAAACGAAAACCAGGCCTGCTGCCAGAGAGAGCTTGGCTGCCAATTAGCAAATCTGAGATGGAGGCGCTGGCGCAGGAGGCGGAGCTACAGGGGAGCTGGCCCTTAAGCTGGTCAGAGCAGACCACTAACGAAGAGAAGAGAAATATTGTTGTAGCAGATGACGCAGCCTTTCGGGAAAAGAGTAAACTACTGACCGCTATGGAGCGACAAAAATGGCTCAATTCTTACATGCAGAAACTGCTTGTGGTGAATTCCCAGTGA

Function

GO:

id name namespace
GO:2000273 positive regulation of signaling receptor activity biological_process
GO:0006171 cAMP biosynthetic process biological_process
GO:0048018 receptor ligand activity molecular_function

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00000322 True 297 mRNA 0.51 1 11636740 11637036

Neighbor

gene id symbol gene type direction distance location
AMCG00000349 NA coding downstream 163480 11310759 ~ 11473260 (-)
AMCG00000320 NA coding downstream 415226 11220920 ~ 11221514 (-)
AMCG00000319 NA coding downstream 426604 11207449 ~ 11210136 (-)
AMCG00000318 NA coding downstream 775215 10858755 ~ 10861525 (-)
AMCG00000317 LOC107733188,LOC106611223,LOC106602554,LOC108433921,LOC108270174 coding downstream 809752 10814984 ~ 10826988 (-)
AMCG00000321 LOC105356882 coding upstream 25821 11662857 ~ 11669320 (-)
AMCG00000330 atg14 coding upstream 73638 11710674 ~ 11726189 (-)
AMCG00000331 tbp coding upstream 89564 11726600 ~ 11730877 (-)
AMCG00000329 NA coding upstream 97791 11734827 ~ 11760237 (-)
AMCG00000328 NA coding upstream 136363 11773399 ~ 11781063 (-)
G149616 NA non-coding downstream 109648 11526870 ~ 11527092 (-)
G149603 NA non-coding downstream 198921 11437367 ~ 11437819 (-)
G149596 NA non-coding downstream 268509 11338391 ~ 11368231 (-)
G149573 NA non-coding downstream 460674 11175681 ~ 11176066 (-)
G149567 NA non-coding downstream 502549 11133401 ~ 11134191 (-)
G149665 NA non-coding upstream 144167 11781203 ~ 11782635 (-)
G149722 NA non-coding upstream 348811 11985847 ~ 11986112 (-)
G149723 NA non-coding upstream 349156 11986192 ~ 11986519 (-)
G149730 NA non-coding upstream 360802 11997838 ~ 11999294 (-)
G149754 NA non-coding upstream 450560 12087596 ~ 12087970 (-)
AMCG00000300 NA other downstream 1577740 10029727 ~ 10059000 (-)
G149441 NA other downstream 1701190 9930970 ~ 9935550 (-)
G149402 NA other downstream 1804607 9831755 ~ 9832133 (-)
G149395 NA other downstream 1869946 9756381 ~ 9766794 (-)
G149341 sos2 other downstream 2095481 9540611 ~ 9541259 (-)
AMCG00000334 NA other upstream 150053 11787089 ~ 11808825 (-)
AMCG00000336 NA other upstream 203444 11840480 ~ 11847948 (-)
G149751 NA other upstream 444507 12081543 ~ 12083214 (-)
G149847 NA other upstream 885484 12522520 ~ 12542310 (-)
G150138 NA other upstream 2186918 13823954 ~ 13826709 (-)

Expression


Co-expression Network