AMCG00000445 (esrrb)


Basic Information

Item Value
gene id AMCG00000445
gene name esrrb
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030141.1
NCBI id CM030141.1
chromosome length 22147039
location 14939745 ~ 14943179 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00000445
ATGAGCCTGCTGCAGAGCGCCTGGATGGAGATCCTCATCCTCAGCATCGTGTTTCGCTCGCTGCCCTACGAGGACGAGCTGGTGTACGCCGAGGATTACATCATGGACGAGGAGCACTCGCGCCTCACCGGCCTGCTCGACCTCTACGTGTCCATCCTGCAGCTGGTGCGCAAGTACAAGAAGCTCAAGGTGGAGAAGGAGGAGTTCGTCACGCTGAAGGCCATCGCACTCGCCAACTCGGATTCCATGCACATAGAGGACGTGGAGGCCGTGCAGAAGCTCCAGGATGCCCTTCACGAGGCCTTGCAGGACTATGAGGGCAGCCAGCACCAGGAGGACCCGCGGCGGGCAGGCAAGCTGCTTATGACCCTCCCGCTCCTCCGACAGACCGCCACCAAAGCAGTGCAGCACTTTTACAGCATCAAACTCCAGGGCAAGGTGCCCATGCACAAACTCTTCCTGGAAATGTTAGAGGCCAAAGTCTGA

Function

symbol description
esrrb Predicted to enable several functions, including DNA-binding transcription factor activity; steroid hormone receptor activity; and zinc ion binding activity. Predicted to act upstream of or within regulation of transcription, DNA-templated. Predicted to be located in nucleus. Is expressed in basal plate midbrain region; nervous system; and pronephric duct. Human ortholog(s) of this gene implicated in autosomal recessive nonsyndromic deafness 35. Orthologous to human ESRRB (estrogen related receptor beta).

NR:

description
PREDICTED: steroid hormone receptor ERR2 isoform X5

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00000445 True 486 mRNA 0.59 2 14939745 14943179

Neighbor

gene id symbol gene type direction distance location
AMCG00000444 vash1,LOC106589786 coding downstream 49215 14881250 ~ 14890530 (-)
AMCG00000453 NA coding downstream 71088 14862756 ~ 14868657 (-)
AMCG00000455 NA coding downstream 78921 14860339 ~ 14860824 (-)
AMCG00000454 NA coding downstream 80757 14839239 ~ 14858988 (-)
AMCG00000451 NA coding downstream 115136 14822861 ~ 14824609 (-)
AMCG00000446 esrrb coding upstream 11489 14954668 ~ 14976422 (-)
AMCG00000442 NA coding upstream 98961 15042140 ~ 15065371 (-)
AMCG00000459 ift43,LOC106590872 coding upstream 148963 15092142 ~ 15108451 (-)
AMCG00000458 ttll5 coding upstream 198217 15141396 ~ 15180517 (-)
AMCG00000466 flvcr2,LOC108242486 coding upstream 244020 15187199 ~ 15211871 (-)
G150427 NA non-coding downstream 48039 14890534 ~ 14891706 (-)
G150306 NA non-coding downstream 444085 14495459 ~ 14495660 (-)
G150219 NA non-coding downstream 785899 14151588 ~ 14153846 (-)
G150119 arf6,arf6a,ARF6,arf6.2,LOC106608083,LOC105893149,LOC104956700 non-coding downstream 1178148 13756516 ~ 13761597 (-)
G150115 NA non-coding downstream 1193615 13739796 ~ 13746130 (-)
G150476 NA non-coding upstream 285718 15228897 ~ 15229292 (-)
G150485 NA non-coding upstream 307446 15250625 ~ 15250829 (-)
G150502 NA non-coding upstream 318208 15261387 ~ 15263576 (-)
G150504 NA non-coding upstream 328217 15271396 ~ 15273123 (-)
G150497 NA non-coding upstream 332784 15275963 ~ 15278056 (-)
AMCG00000436 NA other downstream 367313 14569962 ~ 14572432 (-)
AMCG00000425 entpd5,LOC107586906,LOC105908609,LOC106571572,LOC106608092 other downstream 678413 14245817 ~ 14261332 (-)
AMCG00000409 exoc5 other downstream 910818 14003076 ~ 14028927 (-)
G150138 NA other downstream 1113036 13823954 ~ 13826709 (-)
G149847 NA other downstream 2397435 12522520 ~ 12542310 (-)
AMCG00000457 NA other upstream 180846 15124025 ~ 15137923 (-)
AMCG00000464 batf other upstream 270223 15213402 ~ 15222743 (-)
AMCG00000475 NA other upstream 346124 15289303 ~ 15291255 (-)
AMCG00000482 NA other upstream 518667 15461846 ~ 15479049 (-)
AMCG00000469 LOC108413331,LOC107549545,LOC107582175,LOC108269530,LOC108423442 other upstream 554993 15498172 ~ 15527390 (-)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
zebrafish (Danio rerio) XLOC_011776 esrrb coding NC_007128.7 CM002901.2 52300018 ~ 52386518 (+)
grasscarp (Ctenopharyngodon idella) CI01000316_00190659_00237560 ESRRB coding CI01000316 null 190659 ~ 237560 (-)