AMCG00000446 (esrrb)


Basic Information

Item Value
gene id AMCG00000446
gene name esrrb
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030141.1
NCBI id CM030141.1
chromosome length 22147039
location 14954668 ~ 14976422 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00000446
ATGGCTGCTGATGATCGACACCTGACCTCCAGCTGTGGGTCCTACATCAAGACAGAGCCGTCCAGCCCCTCGTCCGTCATCGACACGGTGAGCCACCACAGCCCCAGCGGGAACTCGGACGCCAGCGGCGGGTATGTGAGCACCATGAACGGCCACTCCAACGGCCTGGACTCGCCGCCAATGTTCCCTGGCTCCGGACTGGGCGGAGGGGCCTGCCGCAAGCGCTACGACGACTGCTCCAGCACCATCATGGAGGACTCGCCAATAAAGTGCGAATACATGTTGAACTCCATTCCCAAGAGACTCTGCCTGGTCTGTGGAGATATTGCTTCGGGTTACCACTATGGAGTGGCTTCCTGCGAGGCTTGCAAAGCCTTTTTTAAAAGGACGATACAAGGTGTGCGTCTGGACCGCGTCCGAGGGGGGCGACAGAAGTACAAGAGGAGGATGGACAGTGAAAACAGTGCGTACCTGGGGCTCACGCTGCCGCCACCAGCAAAAAAGCCATTGACGAAAATAGTGTCTCACCTCCTGGTGGCAGAGCCAGAGAAGATCTATGCAATGCCAGACCCCACCATGCCAGAGAGTGACATCAAGGCATTGACCACCCTGTGTGACCTGGCTGACCGCGAGCTGGTTGTTATCATCGGCTGGGCCAAACATATCCCAGGTAAAACAGGGACCATCTCTCAGCCGCTCGCTCGTGGGCCTGGTGTCACCTCCAACTTGTAA

Function

symbol description
esrrb Predicted to enable several functions, including DNA-binding transcription factor activity; steroid hormone receptor activity; and zinc ion binding activity. Predicted to act upstream of or within regulation of transcription, DNA-templated. Predicted to be located in nucleus. Is expressed in basal plate midbrain region; nervous system; and pronephric duct. Human ortholog(s) of this gene implicated in autosomal recessive nonsyndromic deafness 35. Orthologous to human ESRRB (estrogen related receptor beta).

NR:

description
PREDICTED: steroid hormone receptor ERR2 isoform X5

GO:

id name namespace
GO:0006355 regulation of transcription, DNA-templated biological_process
GO:0043401 steroid hormone mediated signaling pathway biological_process
GO:0005634 nucleus cellular_component
GO:0043565 sequence-specific DNA binding molecular_function
GO:0005496 steroid binding molecular_function
GO:0003700 DNA-binding transcription factor activity molecular_function
GO:0003707 steroid hormone receptor activity molecular_function
GO:0008270 zinc ion binding molecular_function

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00000446 True 732 mRNA 0.58 4 14954668 14976422

Neighbor

gene id symbol gene type direction distance location
AMCG00000445 esrrb coding downstream 11489 14939745 ~ 14943179 (-)
AMCG00000444 vash1,LOC106589786 coding downstream 64138 14881250 ~ 14890530 (-)
AMCG00000453 NA coding downstream 86011 14862756 ~ 14868657 (-)
AMCG00000455 NA coding downstream 93844 14860339 ~ 14860824 (-)
AMCG00000454 NA coding downstream 95680 14839239 ~ 14858988 (-)
AMCG00000442 NA coding upstream 65718 15042140 ~ 15065371 (-)
AMCG00000459 ift43,LOC106590872 coding upstream 115720 15092142 ~ 15108451 (-)
AMCG00000458 ttll5 coding upstream 164974 15141396 ~ 15180517 (-)
AMCG00000466 flvcr2,LOC108242486 coding upstream 210777 15187199 ~ 15211871 (-)
AMCG00000463 atf3,jdp2,LOC106611045 coding upstream 253866 15230288 ~ 15242153 (-)
G150427 NA non-coding downstream 62962 14890534 ~ 14891706 (-)
G150306 NA non-coding downstream 459008 14495459 ~ 14495660 (-)
G150219 NA non-coding downstream 800822 14151588 ~ 14153846 (-)
G150119 arf6,arf6a,ARF6,arf6.2,LOC106608083,LOC105893149,LOC104956700 non-coding downstream 1193071 13756516 ~ 13761597 (-)
G150115 NA non-coding downstream 1208538 13739796 ~ 13746130 (-)
G150476 NA non-coding upstream 252475 15228897 ~ 15229292 (-)
G150485 NA non-coding upstream 274203 15250625 ~ 15250829 (-)
G150502 NA non-coding upstream 284965 15261387 ~ 15263576 (-)
G150504 NA non-coding upstream 294974 15271396 ~ 15273123 (-)
G150497 NA non-coding upstream 299541 15275963 ~ 15278056 (-)
AMCG00000436 NA other downstream 382236 14569962 ~ 14572432 (-)
AMCG00000425 entpd5,LOC107586906,LOC105908609,LOC106571572,LOC106608092 other downstream 693336 14245817 ~ 14261332 (-)
AMCG00000409 exoc5 other downstream 925741 14003076 ~ 14028927 (-)
G150138 NA other downstream 1127959 13823954 ~ 13826709 (-)
G149847 NA other downstream 2412358 12522520 ~ 12542310 (-)
AMCG00000457 NA other upstream 147603 15124025 ~ 15137923 (-)
AMCG00000464 batf other upstream 236980 15213402 ~ 15222743 (-)
AMCG00000475 NA other upstream 312881 15289303 ~ 15291255 (-)
AMCG00000482 NA other upstream 485424 15461846 ~ 15479049 (-)
AMCG00000469 LOC108413331,LOC107549545,LOC107582175,LOC108269530,LOC108423442 other upstream 521750 15498172 ~ 15527390 (-)

Expression


Co-expression Network