G148146 (mthfd1,LOC106952296,LOC105908326,LOC103136077)


Basic Information

Item Value
gene id G148146
gene name mthfd1,LOC106952296,LOC105908326,LOC103136077
gene type non-coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030141.1
NCBI id CM030141.1
chromosome length 22147039
location 4173437 ~ 4175716 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>TU186391
CTTACACAAGCAAAGACGTTGAGTTTGAGATGGGCTCCTAGGGCCTGGACCAGACCCACAGTAGTAGTACTTTTGCCTTCACCCAGGGGAGTGGGAGTTATGCCCGTAACAACCACGTATTTCCCGTCCGGCTGGGATTCAAGTCTCTTGATCGTGGACAGCAGCACTTTCGCTTTGGTTTTGCCATACATCTCCACCTCGTCCGACAAGAGCCCAACCTCCCTTGCCAGTTTGTCGATGGGTTTCGGGGGGCAGGACCTTGAGATTTCGATATCGCTTGGCACGGGTTTCTGTAAGTTCAGCTTGTTGTACTGGATGTTCCATTTTCCTGGGCTGAAGGTTTGAAGGAAGCGTTTGGCACTCTCTACAGTATTCTCCATTAGCATTGCCACCGTCATTGGTCCAACACCACCTGGCACAGGGGTGATAAACCCAGCCCTCTCTTTGGCAGAACTGTACTCGACGTCTCCCACTACCCGCTTGCCACTAGCCTTGGTATTATCTGGAATGTGATTGATGCCACAGTCTATGACAACAGCTCCTTTCTTCACCCAATCTCCCTTCAC

Function

symbol description
mthfd1 Enables formate-tetrahydrofolate ligase activity; methenyltetrahydrofolate cyclohydrolase activity; and methylenetetrahydrofolate dehydrogenase [NAD(P)+] activity. Involved in carboxylic acid biosynthetic process and tetrahydrofolate interconversion. Located in cytosol. Implicated in several diseases, including Down syndrome; cleft lip; developmental cardiac valvular defect; neural tube defect (multiple); and tetralogy of Fallot. Biomarker of Down syndrome.

NR:

description
PREDICTED: C-1-tetrahydrofolate synthase, cytoplasmic isoform X2

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU186391 True 566 lncRNA 0.51 5 4173437 4175716

Neighbor

gene id symbol gene type direction distance location
AMCG00000114 NA coding upstream 38027 4131629 ~ 4135410 (+)
AMCG00000108 NA coding upstream 102003 4044112 ~ 4071434 (+)
AMCG00000109 myh6,LOC102786665,LOC103031694,LOC108251423,LOC107589804 coding upstream 164149 3998178 ~ 4009288 (+)
AMCG00000103 NA coding upstream 197014 3957641 ~ 3976423 (+)
AMCG00000104 NA coding upstream 232644 3928472 ~ 3940793 (+)
AMCG00000112 NA coding downstream 16118 4191834 ~ 4225082 (+)
AMCG00000111 NA coding downstream 67932 4243648 ~ 4280265 (+)
AMCG00000110 NA coding downstream 148793 4324509 ~ 4354247 (+)
AMCG00000121 NA coding downstream 509873 4685589 ~ 4705926 (+)
AMCG00000120 NA coding downstream 581268 4756984 ~ 4760814 (+)
G148143 NA non-coding upstream 11126 4160855 ~ 4162311 (+)
G148119 NA non-coding upstream 160034 4011654 ~ 4013403 (+)
G148075 NA non-coding upstream 293916 3876371 ~ 3879521 (+)
G148036 NA non-coding upstream 414434 3728325 ~ 3759003 (+)
G148010 NA non-coding upstream 485206 3687963 ~ 3688231 (+)
G148200 NA non-coding downstream 406595 4582311 ~ 4582551 (+)
G148396 NA non-coding downstream 1178235 5353951 ~ 5354185 (+)
G148402 NA non-coding downstream 1206852 5382568 ~ 5388814 (+)
G148452 NA non-coding downstream 1364963 5540679 ~ 5544478 (+)
G148459 NA non-coding downstream 1502267 5677983 ~ 5678620 (+)
G148040 NA other upstream 412813 3760179 ~ 3760624 (+)
AMCG00000093 srp14,LOC106610862 other upstream 449121 3720985 ~ 3724316 (+)
AMCG00000094 NA other upstream 474344 3690772 ~ 3699093 (+)
G147726 LOC104962440 other upstream 1769465 2403730 ~ 2403972 (+)
AMCG00000073 mta1,LOC107679789,LOC107666257,LOC107600838 other upstream 2114667 2036023 ~ 2058770 (+)
AMCG00000136 btbd7 other downstream 912723 5088439 ~ 5161195 (+)
AMCG00000145 NA other downstream 1131474 5307190 ~ 5314953 (+)
AMCG00000146 NA other downstream 1158797 5334513 ~ 5340550 (+)
AMCG00000142 NA other downstream 1259442 5435158 ~ 5454206 (+)
AMCG00000166 srsf5,LOC106602985,LOC106611464 other downstream 1705307 5881023 ~ 5888027 (+)

Expression


Co-expression Network