G149573


Basic Information

Item Value
gene id G149573
gene name NA
gene type non-coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030141.1
NCBI id CM030141.1
chromosome length 22147039
location 11175681 ~ 11176066 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>TU188218
ggccttaatcccatagaaaatctgtggagggagctgaaggttcgagttgccaaacgtcagcctcgaaaccttaatgacttggagaggatctgcaaagaggagtgggacaaaatccctcctgagatgtgtgcaaacctggtggccaactacaagaaacgtctgacctctgtgattgccaacaagggttttgccaagtcgaaggggtcaaatacttatttccctcattaacatgcaaatcaatttataacttttttgaaatgcgtttttctggatttctttgttgttattctgtctctcactgttaaaatacacctaccattaaaattatagactgatcatttctttgtcagtgggcaaacgtacaaaatcagcaggggatcaaatac

Function

GO: NA

KEGG:

id description
ko04151 PI3K-Akt signaling pathway
ko04512 ECM-receptor interaction
ko04510 Focal adhesion
ko04974 Protein digestion and absorption

RNA

RNA id representative length rna type GC content exon number start site end site
TU188218 True 386 lncRNA 0.41 1 11175681 11176066

Neighbor

gene id symbol gene type direction distance location
AMCG00000318 NA coding downstream 314156 10858755 ~ 10861525 (-)
AMCG00000317 LOC107733188,LOC106611223,LOC106602554,LOC108433921,LOC108270174 coding downstream 348693 10814984 ~ 10826988 (-)
AMCG00000316 LOC106571665 coding downstream 391958 10780110 ~ 10783723 (-)
AMCG00000295 LOC108443923,LOC108270253 coding downstream 882209 10278809 ~ 10293472 (-)
AMCG00000296 gphna,LOC107752769,LOC107657705 coding downstream 966453 10161709 ~ 10209228 (-)
AMCG00000319 NA coding upstream 31383 11207449 ~ 11210136 (-)
AMCG00000320 NA coding upstream 44854 11220920 ~ 11221514 (-)
AMCG00000349 NA coding upstream 134693 11310759 ~ 11473260 (-)
AMCG00000322 NA coding upstream 460674 11636740 ~ 11637036 (-)
AMCG00000321 LOC105356882 coding upstream 486791 11662857 ~ 11669320 (-)
G149567 NA non-coding downstream 41490 11133401 ~ 11134191 (-)
G149539 NA non-coding downstream 463000 10712477 ~ 10712681 (-)
G149532 NA non-coding downstream 580746 10594726 ~ 10594935 (-)
G149438 NA non-coding downstream 1254659 9919912 ~ 9921022 (-)
G149414 NA non-coding downstream 1277931 9894546 ~ 9897750 (-)
G149596 NA non-coding upstream 162325 11338391 ~ 11368231 (-)
G149603 NA non-coding upstream 261301 11437367 ~ 11437819 (-)
G149616 NA non-coding upstream 350804 11526870 ~ 11527092 (-)
G149665 NA non-coding upstream 605137 11781203 ~ 11782635 (-)
G149722 NA non-coding upstream 809781 11985847 ~ 11986112 (-)
AMCG00000300 NA other downstream 1116681 10029727 ~ 10059000 (-)
G149441 NA other downstream 1240131 9930970 ~ 9935550 (-)
G149402 NA other downstream 1343548 9831755 ~ 9832133 (-)
G149395 NA other downstream 1408887 9756381 ~ 9766794 (-)
G149341 sos2 other downstream 1634422 9540611 ~ 9541259 (-)
AMCG00000334 NA other upstream 611023 11787089 ~ 11808825 (-)
AMCG00000336 NA other upstream 664414 11840480 ~ 11847948 (-)
G149751 NA other upstream 905477 12081543 ~ 12083214 (-)
G149847 NA other upstream 1346454 12522520 ~ 12542310 (-)
G150138 NA other upstream 2647888 13823954 ~ 13826709 (-)

Expression


Co-expression Network