G151725



Basic Information


Item Value
gene id G151725
gene name NA
gene type non-coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information


Item Value
chromosome id CM030141.1
NCBI id CM030141.1
chromosome length 22147039
location 20914441 ~ 20914680 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence


>TU191027
TGTGGTTCCAGGCCGCTGGGCACAGTAGGCGATTGGGACCCGTTCACGCTGACAAAGGGCCTGGGGTCCCCTGGGACAGAGGCCAGGGCAACGCCACCCTGCAGTCTCTCCACCCAGCGCTGCTGCAGCTCCCGACACGGGGCGGAGAACAGGTACTGACCCCCATCGCTCAGCCTGAGGGACAGACGGAGAGACACCAGGTGGATCAACGTGGCCCAACTCTGCTCCTCTGGTTTCTGA

Function


GO: NA

KEGG:

id description
ko04972 Pancreatic secretion
ko04974 Protein digestion and absorption

RNA


RNA id representative length rna type GC content exon number start site end site
TU191027 True 240 lncRNA 0.65 1 20914441 20914680

Neighbor


gene id symbol gene type direction distance location
AMCG00000646 NA coding downstream 69875 20839205 ~ 20844566 (-)
AMCG00000647 NA coding downstream 76935 20836384 ~ 20837506 (-)
AMCG00000645 tecpr2,LOC106600983 coding downstream 78514 20812280 ~ 20835927 (-)
AMCG00000644 NA coding downstream 122863 20770081 ~ 20791578 (-)
AMCG00000636 NA coding downstream 173377 20734583 ~ 20741064 (-)
AMCG00000652 NA coding upstream 2982 20917662 ~ 20920464 (-)
AMCG00000651 NA coding upstream 20858 20935538 ~ 20938564 (-)
AMCG00000638 LOC106528523,LOC107589717,LOC107756760,LOC107669728,LOC107685091 coding upstream 114732 21029412 ~ 21030347 (-)
AMCG00000639 NA coding upstream 126529 21041209 ~ 21045473 (-)
AMCG00000640 LOC102294743,LOC101473355,LOC100707633,LOC102192616,LOC105930114,LOC103476188 coding upstream 174917 21089597 ~ 21091487 (-)
G151678 NA non-coding downstream 102187 20811540 ~ 20812254 (-)
G151447 NA non-coding downstream 1291054 19621137 ~ 19623387 (-)
G151446 psma3,LOC107729246,LOC107725600 non-coding downstream 1295373 19612250 ~ 19619068 (-)
G151416 NA non-coding downstream 1431134 19481328 ~ 19483307 (-)
G151393 NA non-coding downstream 1514348 19398722 ~ 19400093 (-)
G151726 NA non-coding upstream 561 20915241 ~ 20916217 (-)
G151727 NA non-coding upstream 1550 20916230 ~ 20917085 (-)
G151739 NA non-coding upstream 65393 20980073 ~ 20980345 (-)
AMCG00000635 NA other downstream 161784 20744379 ~ 20752657 (-)
G151593 NA other downstream 279495 20632089 ~ 20634946 (-)
AMCG00000618 timm9,LOC107729247,LOC107689314,LOC107693171 other downstream 1267834 19643864 ~ 19646607 (-)
AMCG00000613 NA other downstream 1383387 19503699 ~ 19531054 (-)
AMCG00000599 NA other downstream 1577699 19333717 ~ 19336742 (-)
AMCG00000653 NA other upstream 12011 20926691 ~ 20935429 (-)
G151771 NA other upstream 523587 21438267 ~ 21457795 (-)

Expression



Co-expression Network