AMCG00000682 (ramp1)


Basic Information

Item Value
gene id AMCG00000682
gene name ramp1
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030137.1
NCBI id CM030137.1
chromosome length 27060302
location 66652 ~ 76336 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00000682
ATGCCCCAGGGGCTGATGGGCAGCTGCGGTGGTGTCCTGGCTGCCTCCCTGCGTCCCACCTGTCCCTCGGCGTCCCGGCGGGTGGATTTGCTGGAGACCGCGCTGAGAGGGGCTTCTGTCTGTTGGGTCACAAGCGACGATCCTACATGTCACAGTGAGGTGAAGCTCAGCAGTGTCTGTCGGAGCGGCCACACGGTGAAACCACATGAAACGGGCATCGATGCCGGTGCCGTGAATCCCCGAGACCCAGAGGAGCGCGTGTCTCTGACAGAAGTCTGCTGGCGGCCGCGTCTGATGGCCGGGCTGAGACTCGCCTCCCATCACTTCATTTCTGTGACGGCCTGCGATGAGGCCTTCTACGTCCACGCCATCGAGGAGCACTGCCTGGCCAAGTTCCGGTTCGACATGGAAGCGCTAGACCAGCGAGACTGGTGCAACTGGGAGGACACCGTGGAGTCCTACGGTGAACTGACCAACTGCACCTACCTGATCGCGCTCAAGATGGACTGCTTCTGGCCCAACCGGCTGGTGGACGAGTTCTTCATCGGGATCCACCGGCTGTACTTCTGGAACTGCTCCCTGTCCGGCCGGCTGCTCAGTGACCCGCCCACCGACATCCTGGGCCCCTTCATCGCCGTGCCGGTGCTGGTGACGCTGCTCATGACCGCGCTGGTGGTGTGGCGGAGCAAACGCAACGAGGGCATGGTGTGA

Function

symbol description
ramp1 Predicted to enable coreceptor activity. Predicted to be involved in several processes, including angiogenesis; protein localization to plasma membrane; and receptor internalization. Predicted to act upstream of or within intracellular protein transport and regulation of G protein-coupled receptor signaling pathway. Predicted to be located in membrane. Predicted to be integral component of membrane. Predicted to be part of receptor complex. Predicted to be active in cell surface. Orthologous to human RAMP1 (receptor activity modifying protein 1).

NR:

description
receptor activity-modifying protein 1

GO:

id name namespace
GO:0006886 intracellular protein transport biological_process
GO:0008277 regulation of G protein-coupled receptor signaling pathway biological_process
GO:0016021 integral component of membrane cellular_component
GO:0008565 obsolete protein transporter activity molecular_function

KEGG:

id description
K08447 RAMP1; receptor activity modifying protein 1

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00000682 True 711 mRNA 0.63 5 66652 76336

Neighbor

gene id symbol gene type direction distance location
AMCG00000685 NA coding upstream 11323 87659 ~ 90245 (-)
AMCG00000684 NA coding upstream 23733 100069 ~ 110524 (-)
AMCG00000686 pofut2,LOC107741944,LOC107660604,LOC107565035,LOC107714363 coding upstream 35826 112162 ~ 119898 (-)
AMCG00000689 NA coding upstream 55297 131633 ~ 142509 (-)
AMCG00000688 unc80 coding upstream 69443 145779 ~ 192328 (-)
G125497 NA non-coding upstream 14715 91051 ~ 91285 (-)
G125498 NA non-coding upstream 15947 92283 ~ 92655 (-)
G125515 NA non-coding upstream 44944 121280 ~ 127663 (-)
G125578 NA non-coding upstream 299484 375820 ~ 376770 (-)
G125591 NA non-coding upstream 333279 409615 ~ 410817 (-)
AMCG00000687 map2 other upstream 118308 194644 ~ 244177 (-)
AMCG00000710 myo1b other upstream 1231485 1307821 ~ 1312408 (-)
G125814 NA other upstream 1310507 1386843 ~ 1422410 (-)
AMCG00000719 NA other upstream 1402404 1478740 ~ 1500661 (-)
AMCG00000731 NA other upstream 1685693 1762029 ~ 1771025 (-)

Expression


Co-expression Network