AMCG00001030 (ola1,LOC105019904)


Basic Information

Item Value
gene id AMCG00001030
gene name ola1,LOC105019904
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030137.1
NCBI id CM030137.1
chromosome length 27060302
location 12676022 ~ 12679428 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00001030
ATGTCTCCAAAAAAGTCAGATGACGGACCAAAGCAAGCGCCTCTGATTGGCAGGTTTGGGACTTCACTGAAGATTGGCATTGTCGGATTACCAAATGTTGGGAAATCCACCTTCTTCAATGTTCTCACGAAAAGCCAGGCCTCGGCAGAAAACTTCCCCTTCTGTACCATTGACCCCAATGAGAGCAGGGTGCCGATACCCGATGAACGCTATGATTATCTTTGCCAGTTCCACAAGCCTCTCAGCAAAGTTCCTGCGTTTCTTAACGTGGTGGATATTGCTGGTCTGGTGAAGGGAGCCCATGCTGGACAGGGCCTGGGAAATGCTTTCCTGTCACACATCAGTGCCTGTGATGCCATTTTCCACATGACCCGTGAGTACTTTCTTCCTTCCTAG

Function

symbol description
ola1 Predicted to enable ATP hydrolysis activity. Predicted to be located in nucleolus. Predicted to be active in cytoplasm. Orthologous to human OLA1 (Obg like ATPase 1).

NR:

description
PREDICTED: obg-like ATPase 1

GO:

id name namespace
GO:0005525 GTP binding molecular_function

KEGG:

id description
K06942 ychF; ribosome-binding ATPase

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00001030 True 396 mRNA 0.49 3 12676022 12679428

Neighbor

gene id symbol gene type direction distance location
AMCG00001032 ola1,LOC107660044 coding downstream 17633 12652611 ~ 12658389 (-)
AMCG00001034 ola1,LOC107677584 coding downstream 34040 12636744 ~ 12641982 (-)
AMCG00001031 NA coding downstream 58067 12606362 ~ 12617955 (-)
AMCG00001033 LOC106632289,LOC101486364,LOC107740597 coding downstream 74025 12544443 ~ 12601997 (-)
AMCG00001035 LOC106600091,LOC108430841 coding downstream 131605 12535818 ~ 12544417 (-)
AMCG00001040 NA coding upstream 26037 12705465 ~ 12721679 (-)
AMCG00001042 NA coding upstream 53191 12732619 ~ 12739464 (-)
AMCG00001038 chrna1,LOC106595477 coding upstream 72985 12752413 ~ 12760367 (-)
AMCG00001044 chn1,LOC107588230,LOC107600702,LOC100196534,LOC106586243,LOC106581750 coding upstream 86231 12765659 ~ 12777013 (-)
AMCG00001043 chn1,LOC107657347,LOC107742958,LOC107739458 coding upstream 109907 12789335 ~ 12795048 (-)
G128070 NA non-coding downstream 180807 12493178 ~ 12495215 (-)
G128045 NA non-coding downstream 288438 12358559 ~ 12387584 (-)
G127976 NA non-coding downstream 517539 12154508 ~ 12158483 (-)
G127899 NA non-coding downstream 764200 11908986 ~ 11911822 (-)
G127747 NA non-coding downstream 1057917 11615457 ~ 11618105 (-)
G128155 NA non-coding upstream 85484 12764912 ~ 12810017 (-)
G128191 NA non-coding upstream 320154 12999582 ~ 12999876 (-)
G128212 NA non-coding upstream 385712 13065140 ~ 13070429 (-)
G128237 hnrnpa3 non-coding upstream 527446 13206874 ~ 13211855 (-)
G128242 NA non-coding upstream 568461 13247889 ~ 13280730 (-)
AMCG00000960 NA other downstream 1975658 10696856 ~ 10700364 (-)
G127443 NA other downstream 2397811 10274687 ~ 10278211 (-)
G127292 NA other downstream 3256697 9418996 ~ 9419325 (-)
G127039 LOC100136012,LOC107575789 other downstream 5030300 7629915 ~ 7645722 (-)
AMCG00000888 LOC102209482 other downstream 5942205 6689568 ~ 6733817 (-)
AMCG00001041 cir1,si:ch73-167c12.2 other upstream 17749 12697177 ~ 12703910 (-)
AMCG00001039 NA other upstream 46266 12725694 ~ 12732601 (-)
G128160 wipf1 other upstream 52756 12732184 ~ 12751516 (-)
AMCG00001061 cycsb,LOC108273362,LOC108430847,LOC107740584 other upstream 677555 13356983 ~ 13359770 (-)
AMCG00001068 LOC107576050 other upstream 1088113 13767541 ~ 13773878 (-)

Expression


Co-expression Network